TkA02G425290 | RubberDandelionOmics

Gene overview

TkA02G425290

Reference: TK1151 Chr: Chr02 Coordinates: 108013284-108014710 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1338 bp · TkA02G425290|TK1151|cDNA

AAAGCACTCACCTTTCTTCCTTCCATATAATCAAGATTTACAACAGCTACCCAAAAGTCAATCATTCCTTTAATTGCTTTGAGCGTTATCTGCAAGACTGCAATGGGTGATCATTCTCCAAAGGATATCGAAGTTCCTTCCTTTTTTGTATGTCCAATTTCTTTAGAAATCATGAAGGACCCTGTAACGCTATCTACCGGGATCACATATGATCGTGAATCCATAGAGAAATGGTTGTACACTCGAAAAAACAACACGTG...

CDS

Download CDS FASTA

912 bp · TkA02G425290|TK1151|CDS

ATGAGCAATCTGATGAAGTGTTTAAAGAGGCTAAAGACGATCGTTTTGGAAAGTGATATGAATAAACGGTCAATGGAAGCAGTTGGAGCAGCTAATTACCTATCTTACATCGTATGTAATAACCCTAGTTCTGGTGTTGATGGATTTGATAATTTGGTGACGGCAGTTGATGAAGCGGTGAGCATCCTTTACCACCTTCATCTATCAGAAACCGGGATCAAATCATTGTTCGGTAAAAGTGGAGAGTTTGTTGACGCATT...

Protein

Download Protein FASTA

303 aa · TkA02G425290|TK1151|PROTEIN

MSNLMKCLKRLKTIVLESDMNKRSMEAVGAANYLSYIVCNNPSSGVDGFDNLVTAVDEAVSILYHLHLSETGIKSLFGKSGEFVDALTRVMQRATNYESRTYAVLLLKSMFEVAEPIEIMSIKPNLFKELTQILANQISEKATKAALKLLIGACPWGRNRIKAVEAGVVTVLIDTLLDCTEQKRMPEMVLTLLDHLCQCADGRAELLKHGAGLAVVSKKIFRVSEVASGRAVRILHSVAKFSGNTRVVQEMLQLGVVGKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G425290`
TK1151 ID	TkA02G425290
OH-1004 ID	LXL04_014445
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	92.400
Protein coverage (%)	TK1151 98.680 / OH-1004 72.727 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G425290

Location Chr02:108013284-108014710 (-)

Description Similar to PUB23: E3 ubiquitin-protein ligase PUB23

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g35930`	E3 ubiquitin-protein ligase that negatively regulates water stress response.	Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699 Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085
`At3g52450`	E3 ubiquitin-protein ligase that negatively regulates water stress response.	Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress.2008 · DOI: 10.1105/tpc.108.060699 Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085 The ubiquitin ligase PUB22 targets a subunit of the exocyst complex required for PAMP-triggered responses in Arabidopsis.2012 · DOI: 10.1105/tpc.112.104463
`At3g11840`	E3 ubiquitin-protein ligase that acts as a negative regulator of the immunity triggered by the pathogen-associated molecular patterns (PAMPs), in association with PUB22 and PUB23.	Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.2008 · DOI: 10.1016/j.cub.2008.07.085

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014445 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002679 respiratory burst involved in defense response Biological Process

GO:0006952 defense response Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0051865 protein autoubiquitination Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT2G35930

ath:AT3G11840

ath:AT3G19380

ath:AT3G52450

ath:AT5G37490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.499

Rank 1 · TkA02G425290 · TK1151

Nucleus0.408

Rank 2 · TkA02G425290 · TK1151

Cell membrane0.156

Rank 3 · TkA02G425290 · TK1151

Endoplasmic reticulum0.056

Rank 4 · TkA02G425290 · TK1151

Lysosome / Vacuole0.046

Rank 5 · TkA02G425290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01232Mannitol_dh3-157 aa

PF25598ARM_PUB5-301 aa

PF28319ERICH1_C5-22 aa

PF13083KH_KhpA-B53-104 aa

PF03344Daxx59-103 aa

PF07128DUF1380104-193 aa

PF24768ARM_ARMC5125-257 aa

PF30838UBR4_TPR128-193 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G425290	`PF01232`	Mannitol_dh	3	157	0.27	11.9
TkA02G425290	`PF25598`	ARM_PUB	5	301	3.2e-78	264.0
TkA02G425290	`PF28319`	ERICH1_C	5	22	0.14	13.3
TkA02G425290	`PF13083`	KH_KhpA-B	53	104	0.081	13.6
TkA02G425290	`PF03344`	Daxx	59	103	0.073	13.9
TkA02G425290	`PF07128`	DUF1380	104	193	0.12	13.2
TkA02G425290	`PF24768`	ARM_ARMC5	125	257	2e-06	28.2
TkA02G425290	`PF30838`	UBR4_TPR	128	193	0.093	12.6
TkA02G425290	`PF28319`	ERICH1_C	168	196	0.14	13.3
TkA02G425290	`PF30838`	UBR4_TPR	181	211	0.093	12.6
TkA02G425290	`PF01232`	Mannitol_dh	226	298	0.27	11.9
TkA02G425290	`PF24768`	ARM_ARMC5	231	278	2e-06	28.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84TG3`	Arabidopsis thaliana	sp\|Q84TG3\|PUB23_ARATH E3 ubiquitin-protein ligase PUB23	53.900%	Swiss-Prot	High
`Q9SVC6`	Arabidopsis thaliana	sp\|Q9SVC6\|PUB22_ARATH E3 ubiquitin-protein ligase PUB22	50.800%	Swiss-Prot	High
`Q9SF15`	Arabidopsis thaliana	sp\|Q9SF15\|PUB24_ARATH E3 ubiquitin-protein ligase PUB24	30.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card