TkA02G424580 | RubberDandelionOmics

Gene overview

TkA02G424580

Reference: TK1151 Chr: Chr02 Coordinates: 107843736-107845981 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1390 bp · TkA02G424580|TK1151|cDNA

ACAAAACTTAAATGAGGGTCCGTCGTTATCCCCTGTCGAATTCCAATTCCATCGCCACCATTCCAGAAGAAGATGACCCCGCTCGAACTGTCTCGCACACGAACGTCGGTGGAATAGCACTTAGAAAGAAGGCCACCGGAGTGAGGCAATGGCTCCTCCTCGATTCAATGGGTCAGACCCAAGTGGTGCAGGCCGGAAAACACACTGTCATGCGGCGGACGGGCTTACCCGCGCGCGATCTTCGTATTCTCGACCCTATT...

CDS

Download CDS FASTA

1359 bp · TkA02G424580|TK1151|CDS

ATGAGGGTCCGTCGTTATCCCCTGTCGAATTCCAATTCCATCGCCACCATTCCAGAAGAAGATGACCCCGCTCGAACTGTCTCGCACACGAACGTCGGTGGAATAGCACTTAGAAAGAAGGCCACCGGAGTGAGGCAATGGCTCCTCCTCGATTCAATGGGTCAGACCCAAGTGGTGCAGGCCGGAAAACACACTGTCATGCGGCGGACGGGCTTACCCGCGCGCGATCTTCGTATTCTCGACCCTATTTTATCATATCC...

Protein

Download Protein FASTA

452 aa · TkA02G424580|TK1151|PROTEIN

MRVRRYPLSNSNSIATIPEEDDPARTVSHTNVGGIALRKKATGVRQWLLLDSMGQTQVVQAGKHTVMRRTGLPARDLRILDPILSYPSTVLGRERAIVINLEHIKAIITAHEVLLLNSKDPSVAPLVEELQRRILRHHHHATASQEAREDYIDKATSSSMRDDRIHSLDSRDGLKLLQFEFIALEACLEAACTSLDKEARTLEEEAHPALDKLTTKINTLNLECVRQIKSRLVAITGRVQKVRDELEHLLDDDEDMAEMY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G424580`
TK1151 ID	TkA02G424580
OH-1004 ID	LXL04_017310
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.300
Protein coverage (%)	TK1151 99.779 / OH-1004 99.800 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G424580

Location Chr02:107843736-107845981 (-)

Description Similar to MRS2-3: Magnesium transporter MRS2-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19640`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WY50`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`Os01g0908500`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`UniProt: A2WXD3`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release
`Os01g0869200`	Magnesium transporter that may mediate the influx of magnesium.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017310 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015693 magnesium ion transport Biological Process

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0015095 magnesium ion transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G19640

dosa:Os01g0869200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.475

Rank 1 · TkA02G424580 · TK1151

Cytoplasm0.141

Rank 2 · TkA02G424580 · TK1151

Endoplasmic reticulum0.129

Rank 3 · TkA02G424580 · TK1151

Lysosome / Vacuole0.119

Rank 4 · TkA02G424580 · TK1151

Nucleus0.118

Rank 5 · TkA02G424580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22099MRS2-like50-273 aa

PF01544CorA100-164 aa

PF04513Baculo_PEP_C184-236 aa

PF01544CorA195-282 aa

PF04513Baculo_PEP_C216-267 aa

PF22099MRS2-like322-370 aa

PF01544CorA335-406 aa

PF04513Baculo_PEP_C337-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G424580	`PF22099`	MRS2-like	50	273	9.8e-36	123.9
TkA02G424580	`PF01544`	CorA	100	164	0.0087	16.1
TkA02G424580	`PF04513`	Baculo_PEP_C	184	236	5.5	7.8
TkA02G424580	`PF01544`	CorA	195	282	0.0087	16.1
TkA02G424580	`PF04513`	Baculo_PEP_C	216	267	5.5	7.8
TkA02G424580	`PF22099`	MRS2-like	322	370	9.8e-36	123.9
TkA02G424580	`PF01544`	CorA	335	406	0.0087	16.1
TkA02G424580	`PF04513`	Baculo_PEP_C	337	360	5.5	7.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LJN2`	Arabidopsis thaliana	sp\|Q9LJN2\|MRS23_ARATH Magnesium transporter MRS2-3	57.500%	Swiss-Prot	High
`A2WY50`	Oryza sativa subsp. indica	sp\|A2WY50\|MRS2F_ORYSI Magnesium transporter MRS2-F	53.000%	Swiss-Prot	High
`Q8L4S2`	Oryza sativa subsp. japonica	sp\|Q8L4S2\|MRS2F_ORYSJ Magnesium transporter MRS2-F	53.000%	Swiss-Prot	High
`A2WXD3`	Oryza sativa subsp. indica	sp\|A2WXD3\|MRS2E_ORYSI Magnesium transporter MRS2-E	46.200%	Swiss-Prot	Medium
`Q8S1N1`	Oryza sativa subsp. japonica	sp\|Q8S1N1\|MRS2E_ORYSJ Magnesium transporter MRS2-E	46.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card