TkA02G422830 | RubberDandelionOmics

Gene overview

TkA02G422830

Reference: TK1151 Chr: Chr02 Coordinates: 107356906-107359805 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2125 bp · TkA02G422830|TK1151|cDNA

AAAATGTCTTCTGGAAGAATGAAAAGACAAATCTTGAGGAAAAAGAAACCCATTTATAAATTGTAGAGCATTCGGCGTATAAACCATTCCACTCCTAACAAAAGTTCAATATTCCTAATATTTTTCATATTAAATCACCAACAAACAGAACCCATCTCATTCGCATTTTCTCCCAGCCGCCGTCCATCTTTTTCCTCAATTCTATTCCCCATTATTCGGGTTTCTGAGTTTTCGTCCCAATCAATCAACTGCAGTTGCTT...

CDS

Download CDS FASTA

1527 bp · TkA02G422830|TK1151|CDS

ATGGATCAAATGAAGACCGATCAGAGCTTGCAACAAGTAGGTACGAAGAGGCCGAAAACGAAGATTGTGTGTACTTTGGGACCTGCATCTCGGTCGGTTCCAATGGTTGAAAAGTTGTTGAAAGCAGGGATGAACGTTGCTCGCTTCAATTTCTCACATGGATCCTTCGAGTATCATCAGGAAACGCTCGACAATCTCCGGACCGCCATGGATAACACTGGTATCCTCTGTGCCGTCATGCTCGACACCAAAGGTCCAGA...

Protein

Download Protein FASTA

508 aa · TkA02G422830|TK1151|PROTEIN

MDQMKTDQSLQQVGTKRPKTKIVCTLGPASRSVPMVEKLLKAGMNVARFNFSHGSFEYHQETLDNLRTAMDNTGILCAVMLDTKGPEIRTGFLKDGKPVQLKQGQEITISTDYTIKGDEKMICMSYKKLAHDVKPQSVILCADGTISFTVLSCDTENGLVRCRCENTAVLGERKNVNLPGVIVDLPTLTEKDKEDIMKWGVPNKIDMIALSFVRKGSDLVEVHKLLGEHAKTILLMSKVENQEGVANFDDILLNSDAFMV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G422830`
TK1151 ID	TkA02G422830
OH-1004 ID	LXL04_014479
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.606 / OH-1004 93.878 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G422830

Location Chr02:107356906-107359805 (-)

Description Similar to Pyruvate kinase, cytosolic isozyme

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g26390`	Key regulatory enzyme of the glycolytic pathway that catalyzes the final step of glycolysis, converting ADP and phosphoenolpyruvate (PEP) to ATP and pyruvate by essentially irreversible transphosphorylation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014479 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006096 glycolytic process Biological Process

GO:0006950 response to stress Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004743 pyruvate kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016301 kinase activity Molecular Function

GO:0030955 potassium ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G26390

ddi:DDB_G0283247

gmx:547791

nta:107797877

sot:102601328

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.640

Rank 1 · TkA02G422830 · TK1151

Nucleus0.288

Rank 2 · TkA02G422830 · TK1151

Mitochondrion0.139

Rank 3 · TkA02G422830 · TK1151

Cell membrane0.087

Rank 4 · TkA02G422830 · TK1151

Endoplasmic reticulum0.048

Rank 5 · TkA02G422830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00224PK19-343 aa

PF19294DACZ_N181-242 aa

PF03328HpcH_HpaI201-259 aa

PF19294DACZ_N312-360 aa

PF03328HpcH_HpaI316-335 aa

PF02887PK_C378-504 aa

PF19294DACZ_N467-505 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G422830	`PF00224`	PK	19	343	7.8e-147	489.3
TkA02G422830	`PF19294`	DACZ_N	181	242	0.014	15.8
TkA02G422830	`PF03328`	HpcH_HpaI	201	259	0.043	13.8
TkA02G422830	`PF19294`	DACZ_N	312	360	0.014	15.8
TkA02G422830	`PF03328`	HpcH_HpaI	316	335	0.043	13.8
TkA02G422830	`PF02887`	PK_C	378	504	4.3e-22	79.1
TkA02G422830	`PF19294`	DACZ_N	467	505	0.014	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65595`	Arabidopsis thaliana	sp\|O65595\|KPYC_ARATH Probable pyruvate kinase, cytosolic isozyme	83.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card