TkA02G416910 | RubberDandelionOmics

Gene overview

TkA02G416910

Reference: TK1151 Chr: Chr02 Coordinates: 105965996-105967444 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1383 bp · TkA02G416910|TK1151|cDNA

ATGGTTCAAATTCAGCCTCATTTCCTTTTAGTAACATTTCCGGCCCAAGGTCACATCAACCCAGCTCTCCAATTCGCTAAACGACTCCTCCGATTGGGTGTCAAAGTCACCTTCGCCACCTGCCTCTCCGCCTATAACCGCATGGCGAAAGCTGGCCGGATTCCAGACTGTTTGAACTTTGCTGTTTTTTCAGACGGCTTTGACGACGGGTACCGGTCCAAGATCGATGATGCTTCGTTCTACCTGACTCAATTGAGAAG...

CDS

Download CDS FASTA

1383 bp · TkA02G416910|TK1151|CDS

ATGGTTCAAATTCAGCCTCATTTCCTTTTAGTAACATTTCCGGCCCAAGGTCACATCAACCCAGCTCTCCAATTCGCTAAACGACTCCTCCGATTGGGTGTCAAAGTCACCTTCGCCACCTGCCTCTCCGCCTATAACCGCATGGCGAAAGCTGGCCGGATTCCAGACTGTTTGAACTTTGCTGTTTTTTCAGACGGCTTTGACGACGGGTACCGGTCCAAGATCGATGATGCTTCGTTCTACCTGACTCAATTGAGAAG...

Protein

Download Protein FASTA

460 aa · TkA02G416910|TK1151|PROTEIN

MVQIQPHFLLVTFPAQGHINPALQFAKRLLRLGVKVTFATCLSAYNRMAKAGRIPDCLNFAVFSDGFDDGYRSKIDDASFYLTQLRSRGKQSLKETILSCANDGNPITCLVYTILLPWAEEVARELNVPSAVLWIQPASVFRIYYYYFNGYDKLIGDDCKDPSWSIELPGLPLLKSRDLPSFCLPSNTYNFALPLFKEQLEILDSEDRPNILVNTFDELEEDALKEINGKLKMVADGKDPSDTSFGGDLFITSKEYTEWM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G416910`
TK1151 ID	TkA02G416910
OH-1004 ID	LXL04_014525
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	47.700
Protein coverage (%)	TK1151 95.435 / OH-1004 59.054 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G416910

Location Chr02:105965996-105967444 (-)

Description Similar to UGT75C1: UDP-glycosyltransferase 75C1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15550`	Glucosyltransferase that glucosylates kaempferol.	Arabidopsis glucosyltransferases with activities toward both endogenous and xenobiotic substrates.2003 · DOI: 10.1007/s00425-002-0969-0

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014525 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009718 anthocyanin-containing compound biosynthetic process Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009787 regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009835 fruit ripening Biological Process

GO:0009845 seed germination Biological Process

GO:0043473 pigmentation Biological Process

GO:0080148 negative regulation of response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:BAA36421

ag:BAA36423

ag:BAK55736

mdm:103443397

sly:101250450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702

Rank 1 · TkA02G416910 · TK1151

Nucleus0.211

Rank 2 · TkA02G416910 · TK1151

Endoplasmic reticulum0.088

Rank 3 · TkA02G416910 · TK1151

Plastid0.070

Rank 4 · TkA02G416910 · TK1151

Peroxisome0.066

Rank 5 · TkA02G416910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N10-50 aa

PF03033Glyco_transf_2816-41 aa

PF00201UDPGT253-385 aa

PF06722EryCIII-like_C338-410 aa

PF04101Glyco_tran_28_C342-382 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G416910	`PF26168`	Glyco_transf_N	10	50	0.00079	20.1
TkA02G416910	`PF03033`	Glyco_transf_28	16	41	0.2	12.4
TkA02G416910	`PF00201`	UDPGT	253	385	1.1e-28	101.1
TkA02G416910	`PF06722`	EryCIII-like_C	338	410	0.00091	19.9
TkA02G416910	`PF04101`	Glyco_tran_28_C	342	382	0.18	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23406`	Arabidopsis thaliana	sp\|O23406\|U75D1_ARATH UDP-glycosyltransferase 75D1	51.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card