TkA02G415650 | RubberDandelionOmics

Gene overview

TkA02G415650

Reference: TK1151 Chr: Chr02 Coordinates: 105648080-105649463 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

768 bp · TkA02G415650|TK1151|cDNA

AGCAAGTTCTTCCATAAATCTCATTTTTCAGAACAGAGTGTCATAAACCCTAAATAATTTCTCTTCTCCCCTTTCTTCTCATACAGGTTCTGTAAATTCAAACAACCGAAATGGCATTCTACAACAAAGTTGGAAGCCTTATGAGGCAAACTATCTCTCAAACCACAATTTCCAGTGGAAACGTGACAGTATCATCTATGTTTAATGCCTTTCGCGCCATGTCTACAAAACTCTTTATTGGTGGTCTTTCTTATCAAACC...

CDS

Download CDS FASTA

441 bp · TkA02G415650|TK1151|CDS

ATGGCATTCTACAACAAAGTTGGAAGCCTTATGAGGCAAACTATCTCTCAAACCACAATTTCCAGTGGAAACGTGACAGTATCATCTATGTTTAATGCCTTTCGCGCCATGTCTACAAAACTCTTTATTGGTGGTCTTTCTTATCAAACCGATGATCACTCCTTAAAGGAAGCGTTTTCTGGCTTTGGGGAAGTCGTTGAAGCTAGAGTAATAACCGACAGAGAATCCGGAAGATCTAGGGGATTTGGGTTTGTCAACTA...

Protein

Download Protein FASTA

146 aa · TkA02G415650|TK1151|PROTEIN

MAFYNKVGSLMRQTISQTTISSGNVTVSSMFNAFRAMSTKLFIGGLSYQTDDHSLKEAFSGFGEVVEARVITDRESGRSRGFGFVNYTSDDCAKEAMAAMDGQELNGRSIRVSFATERATRTGGFSGGGGGYNRNYGDAEAGNERF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G415650`
TK1151 ID	TkA02G415650
OH-1004 ID	LXL04_014533
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G415650

Location Chr02:105648080-105649463 (+)

Description Similar to RBG2: Glycine-rich RNA-binding protein 2, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g13850`	Promotes the cis-splicing and editing of several mitochondrial RNAs (including NAD5 transcripts).	No verified direct reference in this release
`At3g23830`	Possibly has a role in RNA transcription or processing during stress.	Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress.2005 · DOI: 10.1093/jxb/eri298
`At1g74230`	Possibly has a role in RNA transcription or processing during stress (By similarity).	RNA Recognition Motif-Containing Protein ORRM4 Broadly Affects Mitochondrial RNA Editing and Impacts Plant Development and Flowering.2016 · DOI: 10.1104/pp.15.01280
`At5g61030`	Possibly has a role in RNA transcription or processing during stress (By similarity).	Two RNA recognition motif-containing proteins are plant mitochondrial editing factors.2015 · DOI: 10.1093/nar/gkv245
`At5g47320`	The RNA-binding domain found in RPS19 may functionally replace the missing mitochondrial RPS13.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014533 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006412 translation Biological Process

GO:0006858 extracellular transport Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009631 cold acclimation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009845 seed germination Biological Process

GO:0016554 cytidine to uridine editing Biological Process

GO:0050658 RNA transport Biological Process

GO:0050688 regulation of defense response to virus Biological Process

KEGG gene cross-reference

ath:AT1G74230

ath:AT3G23830

ath:AT4G13850

ath:AT5G47320

ath:AT5G61030

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.866

Rank 1 · TkA02G415650 · TK1151

Plastid0.110

Rank 2 · TkA02G415650 · TK1151

Cytoplasm0.076

Rank 3 · TkA02G415650 · TK1151

Nucleus0.055

Rank 4 · TkA02G415650 · TK1151

Extracellular0.033

Rank 5 · TkA02G415650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16367RRM_738-101 aa

PF00076RRM_141-111 aa

PF26250RRM_RdRP1_262-100 aa

PF29326RRM_MUD2_C83-118 aa

PF26250RRM_RdRP1_2111-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G415650	`PF16367`	RRM_7	38	101	0.00028	21.5
TkA02G415650	`PF00076`	RRM_1	41	111	5e-23	81.5
TkA02G415650	`PF26250`	RRM_RdRP1_2	62	100	0.11	13.7
TkA02G415650	`PF29326`	RRM_MUD2_C	83	118	0.0022	18.8
TkA02G415650	`PF26250`	RRM_RdRP1_2	111	126	0.11	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SVM8`	Arabidopsis thaliana	sp\|Q9SVM8\|RBG2_ARATH Glycine-rich RNA-binding protein 2, mitochondrial	58.500%	Swiss-Prot	High
`Q9LIS2`	Arabidopsis thaliana	sp\|Q9LIS2\|RBG4_ARATH Glycine-rich RNA-binding protein 4, mitochondrial	58.300%	Swiss-Prot	High
`Q9C909`	Arabidopsis thaliana	sp\|Q9C909\|RBG5_ARATH Glycine-rich RNA-binding protein 5, mitochondrial	54.400%	Swiss-Prot	High
`Q9FNR1`	Arabidopsis thaliana	sp\|Q9FNR1\|RBG3_ARATH Glycine-rich RNA-binding protein 3, mitochondrial	49.200%	Swiss-Prot	Medium
`P39697`	Arabidopsis thaliana	sp\|P39697\|RT19_ARATH Small ribosomal subunit protein uS19m	53.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card