TkA02G411910 | RubberDandelionOmics

Gene overview

TkA02G411910

Reference: TK1151 Chr: Chr02 Coordinates: 104793535-104795813 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

900 bp · TkA02G411910|TK1151|cDNA

ATGGTCACTGTTGAGGAGTTCCAAAAGGCTCAACGAGCAGAAGGTCCAGCAACCATTATGGCCATTGGGACAGCTACACCACCGAACTGTGTTCTCCAAAGCACATATCCAGATTACTATTTTCGTATTACAAAAAGTGAGCACATGAATGAACTTAAGGAGAAATTTATACGCATATGTGATAAATCGATGGTCAAAAAACGATACATGTGTTTGACGGAGGACATATTAAAAGAGAAGCCGAGCTTCTGTGCCCACAT...

CDS

Download CDS FASTA

900 bp · TkA02G411910|TK1151|CDS

ATGGTCACTGTTGAGGAGTTCCAAAAGGCTCAACGAGCAGAAGGTCCAGCAACCATTATGGCCATTGGGACAGCTACACCACCGAACTGTGTTCTCCAAAGCACATATCCAGATTACTATTTTCGTATTACAAAAAGTGAGCACATGAATGAACTTAAGGAGAAATTTATACGCATATGTGATAAATCGATGGTCAAAAAACGATACATGTGTTTGACGGAGGACATATTAAAAGAGAAGCCGAGCTTCTGTGCCCACAT...

Protein

Download Protein FASTA

299 aa · TkA02G411910|TK1151|PROTEIN

MVTVEEFQKAQRAEGPATIMAIGTATPPNCVLQSTYPDYYFRITKSEHMNELKEKFIRICDKSMVKKRYMCLTEDILKEKPSFCAHMAPSLDERQEIAIVEIPNLGAEAATQAIKEWGQPQTNTTHLVFCTTTGIDMPGAEYQLMKLIGLLPSIRRVMIYTQAFRGPDEAHADSLVGQALFGDGAAAIIVGSDLLLDVEKPLFQIVSSQTVLPNSEGAIVGHLGEAGLTIELLKDVPVLIAEQIEKSLVEAFQLFGIIDW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G411910`
TK1151 ID	TkA02G411910
OH-1004 ID	LXL04_014574
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	74.400
Protein coverage (%)	TK1151 98.997 / OH-1004 70.638 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G411910`
Location	Chr02:104793535-104795813 (-)
Description	Similar to CHS2: Chalcone synthase 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014574` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009715 chalcone biosynthetic process Biological Process GO:0009813 flavonoid biosynthetic process Biological Process GO:0030639 polyketide biosynthetic process Biological Process GO:0016210 naringenin-chalcone synthase activity Molecular Function GO:0042802 identical protein binding Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.505

Rank 1 · TkA02G411910 · TK1151

Nucleus0.174

Rank 2 · TkA02G411910 · TK1151

Peroxisome0.136

Rank 3 · TkA02G411910 · TK1151

Endoplasmic reticulum0.116

Rank 4 · TkA02G411910 · TK1151

Mitochondrion0.115

Rank 5 · TkA02G411910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00195Chal_sti_synt_N5-162 aa

PF00195Chal_sti_synt_N163-193 aa

PF08545ACP_syn_III179-193 aa

PF02797Chal_sti_synt_C206-291 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G411910	`PF00195`	Chal_sti_synt_N	5	162	1.6e-81	273.8
TkA02G411910	`PF00195`	Chal_sti_synt_N	163	193	1.6e-81	273.8
TkA02G411910	`PF08545`	ACP_syn_III	179	193	0.2	12.3
TkA02G411910	`PF02797`	Chal_sti_synt_C	206	291	5.4e-27	95.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card