TkA02G411680 | RubberDandelionOmics

Gene overview

TkA02G411680

Reference: TK1151 Chr: Chr02 Coordinates: 104734213-104735734 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1429 bp · TkA02G411680|TK1151|cDNA

ACTCAACACACGAACTCCAATTTCCTACTCACCGCTATTGTACGTGTCTACCTTTAATCACCTGAAAATGATTAACATTGAGGAGTTGAGGAAGGCTCAAAGAGCTGAAGGTCCAGCAACAATTATGGCCATAGGGACTGCCACCCCACCTAATTGTGTGCTTCAAAGCACATATCCGGATTACTACTTTCGTGTTACAAAAAGCGAGCACATGAAAGAACTCAAAAACAAATTTACACGCATGTGTGATAAATCAATGA...

CDS

Download CDS FASTA

1170 bp · TkA02G411680|TK1151|CDS

ATGATTAACATTGAGGAGTTGAGGAAGGCTCAAAGAGCTGAAGGTCCAGCAACAATTATGGCCATAGGGACTGCCACCCCACCTAATTGTGTGCTTCAAAGCACATATCCGGATTACTACTTTCGTGTTACAAAAAGCGAGCACATGAAAGAACTCAAAAACAAATTTACACGCATGTGTGATAAATCAATGATCAGGAAAAGACACATGCACTTCACAGAAGAGCTTCTGAAAGAGAAGCCGAACATTTGTGCTTACAT...

Protein

Download Protein FASTA

389 aa · TkA02G411680|TK1151|PROTEIN

MINIEELRKAQRAEGPATIMAIGTATPPNCVLQSTYPDYYFRVTKSEHMKELKNKFTRMCDKSMIRKRHMHFTEELLKEKPNICAYMAPSLDERQDIVVVEVPKLGKEAATRAIKEWGQPKSKITHLVFCTTSGVDMPGADYQLTKLLGLRSSVKRFMMYQQGCFAGGTVLRLAKDLAENNKGARILVVCSEITAITFRGPNETHLDNLVGQALFGDGAAAVIVGSDPLHDAEKPLFELIFASQTLLPDSEGAIDGHLRE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G411680`
TK1151 ID	TkA02G411680
OH-1004 ID	LXL04_014574
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	82.200
Protein coverage (%)	TK1151 98.201 / OH-1004 81.277 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G411680`
Location	Chr02:104734213-104735734 (+)
Description	Similar to CHS2: Chalcone synthase 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014574` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009715 chalcone biosynthetic process Biological Process GO:0009813 flavonoid biosynthetic process Biological Process GO:0030639 polyketide biosynthetic process Biological Process GO:0016210 naringenin-chalcone synthase activity Molecular Function GO:0042802 identical protein binding Molecular Function GO:0042803 protein homodimerization activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.343

Rank 1 · TkA02G411680 · TK1151

Cytoplasm0.317

Rank 2 · TkA02G411680 · TK1151

Peroxisome0.117

Rank 3 · TkA02G411680 · TK1151

Mitochondrion0.096

Rank 4 · TkA02G411680 · TK1151

Nucleus0.089

Rank 5 · TkA02G411680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00195Chal_sti_synt_N5-228 aa

PF08392FAE1_CUT1_RppA127-238 aa

PF08545ACP_syn_III161-230 aa

PF02797Chal_sti_synt_C238-387 aa

PF08541ACP_syn_III_C301-384 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G411680	`PF00195`	Chal_sti_synt_N	5	228	1.3e-122	408.1
TkA02G411680	`PF08392`	FAE1_CUT1_RppA	127	238	1.2e-06	28.8
TkA02G411680	`PF08545`	ACP_syn_III	161	230	1e-05	26.0
TkA02G411680	`PF02797`	Chal_sti_synt_C	238	387	1.1e-68	230.7
TkA02G411680	`PF08541`	ACP_syn_III_C	301	384	2.2e-05	25.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card