TkA02G411280 | RubberDandelionOmics

Gene overview

TkA02G411280

Reference: TK1151 Chr: Chr02 Coordinates: 104618292-104619964 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1185 bp · TkA02G411280|TK1151|cDNA

TAACGTTCTATACTTCTATTAGAAAAGGCGCCTACGACAGCGTATCCGCCGCCCACGCCGTTGCCGGACTACTCAAGCCATCGTTCGGACTTCGGAGTGTACATCGTCCATGCCAACACCATCATTTAGCGAAACCGTTTCCTCCCTCTGATGGAATATGACGAATTTATACAGGAACTCACATCTCCAAAGTGAAGTTAACTCATTTCTAAGGGTACTTATTTAAGACACCATTTCTCTTGAAATGTTGAGGCTCAAAG...

CDS

Download CDS FASTA

762 bp · TkA02G411280|TK1151|CDS

ATGTTGAGGCTCAAAGCAATCACCGCCCTAATTACACCAATGAGTCGACTCAGTATATTCAAAATCCCAAACTCGTCCTTCAGTCAAACCACAATCACCCAAGATCAACCACCCACCCCACCCAATAACAATCACGTTCTTCAAAGACACCATAAAGTATCAAAAAAGGACAAATTAAATGTTTTTGTAACCACACTTATCGATCTCAACAACACCAAAGAAGCAGTCTACGGTACCCTCGACGCGTGGGTTTCAGAGGA...

Protein

Download Protein FASTA

253 aa · TkA02G411280|TK1151|PROTEIN

MLRLKAITALITPMSRLSIFKIPNSSFSQTTITQDQPPTPPNNNHVLQRHHKVSKKDKLNVFVTTLIDLNNTKEAVYGTLDAWVSEERDFPIGRVKTAILTLERKQKWHKAVQVIKWMLSKGHGTTVGTYGQLIRALDMDNRVEEAKRLWGKKLGRNVDSVPWKVCGIMVSVYYRNEMWKDVVKLFEDLEGHNRKCTDKVIVERVGEAYEKLGLVEKKEGVLVKYKSLFSKKRGKYGRKSIKEVEVSKVAVTQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G411280`
TK1151 ID	TkA02G411280
OH-1004 ID	LXL04_014582
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.500
Protein coverage (%)	TK1151 93.676 / OH-1004 87.778 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G411280`
Location	Chr02:104618292-104619964 (-)
Description	Similar to EMB1417: Pentatricopeptide repeat-containing protein At4g21190
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014582` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference	ath:AT4G18975 ath:AT4G21190 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.855

Rank 1 · TkA02G411280 · TK1151

Plastid0.067

Rank 2 · TkA02G411280 · TK1151

Nucleus0.051

Rank 3 · TkA02G411280 · TK1151

Cytoplasm0.030

Rank 4 · TkA02G411280 · TK1151

Cell membrane0.010

Rank 5 · TkA02G411280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13041PPR_2102-137 aa

PF01535PPR105-122 aa

PF01535PPR129-152 aa

PF13041PPR_2133-150 aa

PF01535PPR167-191 aa

PF13041PPR_2168-197 aa

PF21545T7SS_EccA1_N168-216 aa

PF01535PPR208-217 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G411280	`PF13041`	PPR_2	102	137	9.4e-07	29.6
TkA02G411280	`PF01535`	PPR	105	122	0.00036	21.3
TkA02G411280	`PF01535`	PPR	129	152	0.00036	21.3
TkA02G411280	`PF13041`	PPR_2	133	150	9.4e-07	29.6
TkA02G411280	`PF01535`	PPR	167	191	0.00036	21.3
TkA02G411280	`PF13041`	PPR_2	168	197	9.4e-07	29.6
TkA02G411280	`PF21545`	T7SS_EccA1_N	168	216	0.32	10.9
TkA02G411280	`PF01535`	PPR	208	217	0.00036	21.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card