TkA02G407010 | RubberDandelionOmics

Gene overview

TkA02G407010

Reference: TK1151 Chr: Chr02 Coordinates: 103502082-103504426 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1476 bp · TkA02G407010|TK1151|cDNA

AATTGGTCTTGTATATGATGCATCTCGCATCTCAGGAACTTAATAAATTGATCACTTTGTCCTAAACGAGCTGAAACAGAAAGAGAAAGTGCATTTAATACATGAGAGTGTTTTTGCTACATGAACATGTCTTGGAAAAGGGCCAAAACCAAAACACCTGGATGGGCTGCATTCGATCCCAATAAGCAACAAAATCAAGTCACCAATCATGATCCATACCCACCTATCTCAACCAACATTACTCACAAAAATCCTTCACA...

CDS

Download CDS FASTA

1050 bp · TkA02G407010|TK1151|CDS

ATGAACATGTCTTGGAAAAGGGCCAAAACCAAAACACCTGGATGGGCTGCATTCGATCCCAATAAGCAACAAAATCAAGTCACCAATCATGATCCATACCCACCTATCTCAACCAACATTACTCACAAAAATCCTTCACAAAATGCTAATCTCACTGGAAAATCTTTCTCCTCTGTTCTAACTCACTCATCAAATCTTCCAGATATAATGATAGCTACTAATACTCAAAATCCTCCAAGCACTTTAACAGAAAACAGCCA...

Protein

Download Protein FASTA

349 aa · TkA02G407010|TK1151|PROTEIN

MNMSWKRAKTKTPGWAAFDPNKQQNQVTNHDPYPPISTNITHKNPSQNANLTGKSFSSVLTHSSNLPDIMIATNTQNPPSTLTENSQTAKSVKNNFPQVYEKLKELHPWADENLIGDIVTAVDNDFNKASVLLKEMTDSSSLQGKKQENVSVLNVCPDSVLNDNNVALRIMIDSLSMIPMEPEWEDDDDMYIMHRKDAIKAIRSASRYSKAAKEAYLRRDHATAQGLSIKAQEQWSISEKLNAKASKEIFLIRNSENDEW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G407010`
TK1151 ID	TkA02G407010
OH-1004 ID	LXL04_014633
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G407010`
Location	Chr02:103502082-103504426 (-)
Description	Similar to CID7: Polyadenylate-binding protein-interacting protein 7
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014633` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0070481 nuclear-transcribed mRNA catabolic process, non-stop decay Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0071944 cell periphery Cellular Component GO:0003729 mRNA binding Molecular Function GO:0004519 endonuclease activity Molecular Function GO:0016787 hydrolase activity Molecular Function GO:0046404 ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity Molecular Function
KEGG gene cross-reference	ath:AT2G26280 ath:AT5G58720 sce:YPL199C spo:2541436 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA02G407010 · TK1151

Nucleus0.350

Rank 2 · TkA02G407010 · TK1151

Cell membrane0.093

Rank 3 · TkA02G407010 · TK1151

Plastid0.066

Rank 4 · TkA02G407010 · TK1151

Peroxisome0.061

Rank 5 · TkA02G407010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08590DUF1771191-254 aa

PF01713Smr262-321 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G407010	`PF08590`	DUF1771	191	254	1.9e-13	51.2
TkA02G407010	`PF01713`	Smr	262	321	3.2e-06	27.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card