TkA02G406970 | RubberDandelionOmics

Gene overview

TkA02G406970

Reference: TK1151 Chr: Chr02 Coordinates: 103491278-103495040 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2226 bp · TkA02G406970|TK1151|cDNA

TTTTAACGTGAAAAGGATGAACGCCTGATATTTATCATCATATAAGGCTGACGTGCGAGTCAGTAGTTGCTTTAAAGGCGCACGAAGCATAATCGGAGTCCCCAATAAACCACCCCTTTCGCCTTTGCCTTTCAATTCCTACTCCTTTCGCTGCTAGATTGCATCTCTCTTTCTCTCTCCTAAAGTATACGACCGGCGGACTGTGATACCAAGATGGCACCGCCGGCTGCGGTGGAGGGTGGCGACGCTGGTGGTGGAGG...

CDS

Download CDS FASTA

1776 bp · TkA02G406970|TK1151|CDS

ATGGCACCGCCGGCTGCGGTGGAGGGTGGCGACGCTGGTGGTGGAGGACAACCACAGCCACAGCAGGGGTTTGGCCAGATGTTTACCGGAATCATAAGGGTAGCCGTTATATATTACTTCGCATCCAAGTTTTTCTCTCCCGGCGGTAAACCCTCGTCTTCCGGCTCAGAACCTGCTCTTCAGATCTCCAATCTATTCCACAAGGGTGAACTTTTGGATATGTGGTTCTATGTCTCAGAACATGAAAAATTCAACGACTT...

Protein

Download Protein FASTA

591 aa · TkA02G406970|TK1151|PROTEIN

MAPPAAVEGGDAGGGGQPQPQQGFGQMFTGIIRVAVIYYFASKFFSPGGKPSSSGSEPALQISNLFHKGELLDMWFYVSEHEKFNDFGNEQALLWHESNIPYAVWGPESTRTLSLKYYPSEALKHNGSLYSHVFFARSGYPADPSDPEYQPLAAFGLTHPIVAYLPKSKANKKKSLLGNSKDTGEVDAVSEGVEEPQGDLKEDGPVEYISYWKPNITINLVDDFTKYSQRAIPPNVAPYMNFEPTTGNYYPTVFLNEFWL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406970`
TK1151 ID	TkA02G406970
OH-1004 ID	LXL04_014636
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 52.162 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G406970`
Location	Chr02:103491278-103495040 (+)
Description	Similar to clptm1: Cleft lip and palate transmembrane protein 1 homolog
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014636` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0030154 cell differentiation Biological Process GO:0099072 regulation of postsynaptic membrane neurotransmitter receptor levels Biological Process GO:0005886 plasma membrane Cellular Component GO:0009897 external side of plasma membrane Cellular Component GO:0012505 endomembrane system Cellular Component GO:0016020 membrane Cellular Component GO:0050811 GABA receptor binding Molecular Function
KEGG gene cross-reference	bta:618037 ddi:DDB_G0283115 hsa:1209 mmu:56457 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.824

Rank 1 · TkA02G406970 · TK1151

Golgi apparatus0.163

Rank 2 · TkA02G406970 · TK1151

Cytoplasm0.085

Rank 3 · TkA02G406970 · TK1151

Nucleus0.069

Rank 4 · TkA02G406970 · TK1151

Cell membrane0.057

Rank 5 · TkA02G406970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05602CLPTM130-464 aa

PF04193PQ-loop355-382 aa

PF04193PQ-loop472-505 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406970	`PF05602`	CLPTM1	30	464	1.8e-155	518.9
TkA02G406970	`PF04193`	PQ-loop	355	382	0.0019	18.6
TkA02G406970	`PF04193`	PQ-loop	472	505	0.0019	18.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card