RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G406390
Reference: TK1151 Chr: Chr02 Coordinates: 103322851-103325363 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1774 bp · TkA02G406390|TK1151|cDNA

ATATTATTTTACATAAATTTTTTACACATTTAAATTTTTTACAAAACACTTTTACAGAAGTAAAAGAACGACTTCGCTTCCAACTTGTAGTTTTGCCGAACAAAGATCGGGCATGCTTTGGGGACAATACAAGTAGGCTGCTAAAGAACATTCGTTTATTTAGAGAGAGAAACAAAACCCTAAATTTCCACGCTTTCCATCAATCATCTCCCAGAAATCTCGGTGATTCTGGTTCAATTTAGGTCTAGGCTTATCTTTCA...

CDS

Download CDS FASTA

1212 bp · TkA02G406390|TK1151|CDS

ATGTCGGATACTGAGAAAAACGCCCTTGTTAACTCACCAACGAGCTCCCGGTCGGTCACGGAGACAGTAAACGGCTCTCACCATTTCGTTATACAGGGTTATTCCTTAGCCAAAGGTATGGGAATCGGAAAACACATCGCTAGCGATAATTTTACGGTCGGAGGCTATCAATGGGCTGTATACTTCTACCCCGATGGGAAAAATCCTGAAGACAATTCGACATATGTTTCTGTCTTCATTGCACTTGCCAGCGAGGGCAC...

Protein

Download Protein FASTA

403 aa · TkA02G406390|TK1151|PROTEIN

MSDTEKNALVNSPTSSRSVTETVNGSHHFVIQGYSLAKGMGIGKHIASDNFTVGGYQWAVYFYPDGKNPEDNSTYVSVFIALASEGTDVRALFELTLVDQSGKGKHKIHSHFDRSLESGPYTLKYRGSMWGYKRFYRRALLETSDYLKDDCLRINCTVGVVVSAVDCSSLHSIKVPESDIGSHFGTLLDNKEGSDIIFNVSGQKFHAHKLVLAARSPVFRSRFFKQDEEHEHEIDVTDMEPKVFKAMLHFIYRDAVMEDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G406390
TK1151 IDTkA02G406390
OH-1004 IDLXL04_014652
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G406390
LocationChr02:103322851-103325363 (-)
DescriptionSimilar to BPM4: BTB/POZ and MATH domain-containing protein 4
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g03740 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At3g43700 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At5g21010 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At3g06190 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
At5g19000 May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_014652 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0042631 cellular response to water deprivation Biological Process
GO:0071472 cellular response to salt stress Biological Process
GO:0005634 nucleus Cellular Component
GO:0005829 cytosol Cellular Component
GO:0042802 identical protein binding Molecular Function
KEGG gene cross-reference
ath:AT3G03740
ath:AT3G06190
ath:AT3G43700
ath:AT5G19000
ath:AT5G21010
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.642
Rank 1 · TkA02G406390 · TK1151
Cytoplasm0.415
Rank 2 · TkA02G406390 · TK1151
Cell membrane0.122
Rank 3 · TkA02G406390 · TK1151
Endoplasmic reticulum0.050
Rank 4 · TkA02G406390 · TK1151
Mitochondrion0.026
Rank 5 · TkA02G406390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22486MATH_227-158 aa
PF00917MATH47-158 aa
PF21355TRAF-mep_MATH48-154 aa
PF24570BACK_BPM_SPOP146-153 aa
PF00651BTB186-302 aa
PF02214BTB_2197-255 aa
PF07707BACK238-256 aa
PF24570BACK_BPM_SPOP277-295 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G406390PF22486MATH_2271589.8e-31107.5
TkA02G406390PF00917MATH471580.002618.7
TkA02G406390PF21355TRAF-mep_MATH481542.5e-0525.4
TkA02G406390PF24570BACK_BPM_SPOP1461531.3e-1661.2
TkA02G406390PF00651BTB1863024.2e-2692.0
TkA02G406390PF02214BTB_21972550.1812.9
TkA02G406390PF07707BACK2382560.001519.3
TkA02G406390PF24570BACK_BPM_SPOP2772951.3e-1661.2
TkA02G406390PF07707BACK2803030.001519.3
TkA02G406390PF26017BACK_BTBD83053600.212.7
TkA02G406390PF00651BTB3073344.2e-2692.0
TkA02G406390PF24570BACK_BPM_SPOP3083591.3e-1661.2
TkA02G406390PF21872SAM_53103610.03314.7
TkA02G406390PF07707BACK3123490.001519.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SRV1Arabidopsis thalianasp|Q9SRV1|BPM4_ARATH BTB/POZ and MATH domain-containing protein 472.600%Swiss-ProtHigh
A1L4W5Arabidopsis thalianasp|A1L4W5|BPM6_ARATH BTB/POZ and MATH domain-containing protein 666.200%Swiss-ProtHigh
Q1EBV6Arabidopsis thalianasp|Q1EBV6|BPM5_ARATH BTB/POZ and MATH domain-containing protein 566.200%Swiss-ProtHigh
Q9M8J9Arabidopsis thalianasp|Q9M8J9|BPM2_ARATH BTB/POZ and MATH domain-containing protein 257.800%Swiss-ProtHigh
Q8L765Arabidopsis thalianasp|Q8L765|BPM1_ARATH BTB/POZ and MATH domain-containing protein 155.900%Swiss-ProtHigh

JBrowse

View in Genome Browser