TkA02G406350 | RubberDandelionOmics

Gene overview

TkA02G406350

Reference: TK1151 Chr: Chr02 Coordinates: 103306850-103307593 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · TkA02G406350|TK1151|cDNA

ATGGCCGATCAGAACAGACCCGTCACCGGCTACCCCGCTCCGCCTGCTTCCAACGGCTATCCTACCAACACCGCCACTGCATATCCTTACGTGGCACCGCCCCCACAGAATCAGGGGACCATAGTATTCATCATGTGGCTCATCCTCCGTCCCCAAATCCCTCAGTTCCGTGTAGATACCCTAACCCTATCTAACTTCAACATGTCATCAAACTCCCTGATTTCCGGTACTTGGGACGCTCGTTTCACTGTACGCAACCC...

CDS

Download CDS FASTA

627 bp · TkA02G406350|TK1151|CDS

ATGGCCGATCAGAACAGACCCGTCACCGGCTACCCCGCTCCGCCTGCTTCCAACGGCTATCCTACCAACACCGCCACTGCATATCCTTACGTGGCACCGCCCCCACAGAATCAGGGGACCATAGTATTCATCATGTGGCTCATCCTCCGTCCCCAAATCCCTCAGTTCCGTGTAGATACCCTAACCCTATCTAACTTCAACATGTCATCAAACTCCCTGATTTCCGGTACTTGGGACGCTCGTTTCACTGTACGCAACCC...

Protein

Download Protein FASTA

208 aa · TkA02G406350|TK1151|PROTEIN

MADQNRPVTGYPAPPASNGYPTNTATAYPYVAPPPQNQGTIVFIMWLILRPQIPQFRVDTLTLSNFNMSSNSLISGTWDARFTVRNPNSKIVLYYDRIEAAVFYKSESISETTVPPFAQGKKNETGVRATFVSSSAYVDDRNGISSERSRGTVDFNLRMMARVRFKAGAWWARRRILKIFCPNLSIGVSANSTGGSLVGGSKNCRVTL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G406350`
TK1151 ID	TkA02G406350
OH-1004 ID	LXL04_014654
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	82.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G406350

Location Chr02:103306850-103307593 (-)

Description Similar to NHL10: NDR1/HIN1-like protein 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g35980`	May play a role in plant immunity.	No verified direct reference in this release
`At5g53730`	Involved in the regulation of sugar, amino acid and some primary metabolite export from companion cells (CCs) to sieve elements (SEs) in phloem.	Increased expression of a phloem membrane protein encoded by NHL26 alters phloem export and sugar partitioning in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111849
`At1g08160`	Uncharacterized protein At1g08160.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014654 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009611 response to wounding Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0010150 leaf senescence Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0051607 defense response to virus Biological Process

GO:0051707 response to other organism Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT2G27080

ath:AT2G35980

ath:AT3G11650

ath:AT3G11660

ath:AT5G06320

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.721

Rank 1 · TkA02G406350 · TK1151

Endoplasmic reticulum0.104

Rank 2 · TkA02G406350 · TK1151

Extracellular0.103

Rank 3 · TkA02G406350 · TK1151

Cytoplasm0.093

Rank 4 · TkA02G406350 · TK1151

Nucleus0.058

Rank 5 · TkA02G406350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03168LEA_282-174 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G406350	`PF03168`	LEA_2	82	174	1.3e-10	42.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJ52`	Arabidopsis thaliana	sp\|Q9SJ52\|NHL10_ARATH NDR1/HIN1-like protein 10	33.500%	Swiss-Prot	Medium
`Q9FI03`	Arabidopsis thaliana	sp\|Q9FI03\|NHL26_ARATH NDR1/HIN1-like protein 26	30.400%	Swiss-Prot	Medium
`Q8VZ13`	Arabidopsis thaliana	sp\|Q8VZ13\|Y1816_ARATH Uncharacterized protein At1g08160	26.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card