TkA02G405850 | RubberDandelionOmics

Gene overview

TkA02G405850

Reference: TK1151 Chr: Chr02 Coordinates: 103125147-103134756 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

789 bp · TkA02G405850|TK1151|cDNA

ATGTACACAGATACGTTATTCTTATCTGACAGAGAAGTAAACAGAATTACTATATTTGTGAATAATGATGTATTTAAAGGTGAAGAACAGAAGCCTGTTTCCAATGTTGGCTGTAGCACTGGAATCCTATTGATATTTTGTGCTCAGGCAGGGGCAAAGCGGTTTTATGCCTATGTAAACGTCATATCACCAGGTCTATACCTGGATGCCAGTGAGATAGCATTGCAGGCAAATGAAGTTGTGAAAGCAAATAACCTCTC...

CDS

Download CDS FASTA

789 bp · TkA02G405850|TK1151|CDS

ATGTACACAGATACGTTATTCTTATCTGACAGAGAAGTAAACAGAATTACTATATTTGTGAATAATGATGTATTTAAAGGTGAAGAACAGAAGCCTGTTTCCAATGTTGGCTGTAGCACTGGAATCCTATTGATATTTTGTGCTCAGGCAGGGGCAAAGCGGTTTTATGCCTATGTAAACGTCATATCACCAGGTCTATACCTGGATGCCAGTGAGATAGCATTGCAGGCAAATGAAGTTGTGAAAGCAAATAACCTCTC...

Protein

Download Protein FASTA

262 aa · TkA02G405850|TK1151|PROTEIN

MYTDTLFLSDREVNRITIFVNNDVFKGEEQKPVSNVGCSTGILLIFCAQAGAKRFYAYVNVISPGLYLDASEIALQANEVVKANNLSDKVFVLHGHVEAIQIDEEVDVIVSEWITFLSRNPISKIGGSLGKANSVTKVSHLNCKIQDIDSSVKYCTELRELRLAHSEIGDCCLIPESPFYLEGQGGLFEFIQHRLKENGHVVIVVAEGAGQVYVSNAVNAIEEKDASGNKLLLDIGQWLTQKIKDHFAKVKKVPINMKYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G405850`
TK1151 ID	TkA02G405850
OH-1004 ID	LXL04_014668
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G405850

Location Chr02:103125147-103134756 (-)

Description Similar to PFK4: ATP-dependent 6-phosphofructokinase 4, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61580`	Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.	No verified direct reference in this release
`At4g26270`	Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.	No verified direct reference in this release
`At4g32840`	Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.	No verified direct reference in this release
`At4g29220`	Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.	No verified direct reference in this release
`At5g56630`	Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014668 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006002 fructose 6-phosphate metabolic process Biological Process

GO:0006096 glycolytic process Biological Process

GO:0010053 root epidermal cell differentiation Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003872 6-phosphofructokinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G26270

ath:AT4G29220

ath:AT4G32840

ath:AT5G56630

ath:AT5G61580

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.489

Rank 1 · TkA02G405850 · TK1151

Nucleus0.245

Rank 2 · TkA02G405850 · TK1151

Extracellular0.138

Rank 3 · TkA02G405850 · TK1151

Mitochondrion0.110

Rank 4 · TkA02G405850 · TK1151

Peroxisome0.087

Rank 5 · TkA02G405850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06325PrmA29-111 aa

PF13649Methyltransf_2535-119 aa

PF12799LRR_4117-143 aa

PF12799LRR_4142-169 aa

PF00365PFK169-245 aa

PF13649Methyltransf_25183-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G405850	`PF06325`	PrmA	29	111	0.0033	17.7
TkA02G405850	`PF13649`	Methyltransf_25	35	119	0.098	14.1
TkA02G405850	`PF12799`	LRR_4	117	143	0.0048	17.8
TkA02G405850	`PF12799`	LRR_4	142	169	0.0048	17.8
TkA02G405850	`PF00365`	PFK	169	245	0.008	16.3
TkA02G405850	`PF13649`	Methyltransf_25	183	203	0.098	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FKG3`	Arabidopsis thaliana	sp\|Q9FKG3\|PFKA4_ARATH ATP-dependent 6-phosphofructokinase 4, chloroplastic	70.400%	Swiss-Prot	Low
`Q94AA4`	Arabidopsis thaliana	sp\|Q94AA4\|PFKA3_ARATH ATP-dependent 6-phosphofructokinase 3	65.900%	Swiss-Prot	Low
`Q9M076`	Arabidopsis thaliana	sp\|Q9M076\|PFKA6_ARATH ATP-dependent 6-phosphofructokinase 6	64.800%	Swiss-Prot	Low
`Q9M0F9`	Arabidopsis thaliana	sp\|Q9M0F9\|PFKA1_ARATH ATP-dependent 6-phosphofructokinase 1	66.300%	Swiss-Prot	Low
`Q9C5J7`	Arabidopsis thaliana	sp\|Q9C5J7\|PFKA7_ARATH ATP-dependent 6-phosphofructokinase 7	65.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card