TkA02G405040 | RubberDandelionOmics

Gene overview

TkA02G405040

Reference: TK1151 Chr: Chr02 Coordinates: 102927350-102935731 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4078 bp · TkA02G405040|TK1151|cDNA

AAAGAAAAACATTGACTAAAGTTAAGAGTAAAGGGACTAAACATGTACTTTTTAGTTTTTAGACTAGAAATAATTCAAACCAGACGCGGCCTCCACATTTCAAAATTTTCAAATCTTGAAACACCCAAACGTTCCACTCCATTTGAATCCAACCCCGAATCTCTCCCCCTCTCTCAGTCATCAGCTCAATGCCACACATTTCTGAGACTTCGAGCGACTTCAAGCCTAGATTTGGTTACCAAGAACATTGCCGTCCATCT...

CDS

Download CDS FASTA

3708 bp · TkA02G405040|TK1151|CDS

ATGCCACACATTTCTGAGACTTCGAGCGACTTCAAGCCTAGATTTGGTTACCAAGAACATTGCCGTCCATCTGAGTCGATGCAGCCACCAATCAGGGGCACGCCGGATCTCTTCAAGTCAGTAATGAAAGAGACGCCTTTCAATTCATCTGCCGTTTCCACTTTCAGAGACAGAGGCGATTATTCATCTATTGCGGTCAATCTGAACGATAGTTTTGAGTTCCGAGAAGATCCGTCCTTCTGGAAAGACCATAATGTGCA...

Protein

Download Protein FASTA

1235 aa · TkA02G405040|TK1151|PROTEIN

MPHISETSSDFKPRFGYQEHCRPSESMQPPIRGTPDLFKSVMKETPFNSSAVSTFRDRGDYSSIAVNLNDSFEFREDPSFWKDHNVQVIIRVRPLSDSEIAVQGPSRCVKQGSSQTVTWIGPPEARFTFDHVADEHVSQEMMFKVAGVPMVENCMGGYNSCMFAYGQTGSGKTHTMLGDIDGGSRRHSVNSGMTPRVFEYLFTRIQKEREARREEKIQYTCKCSFLEIYNEQILDLLDPSSSNLQIREDTKKGVYVDNLK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G405040`
TK1151 ID	TkA02G405040
OH-1004 ID	LXL04_014683
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G405040

Location Chr02:102927350-102935731 (+)

Description Similar to KIN12E: Kinesin-like protein KIN-12E

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g44050`	Kinesin-like protein KIN-12E.	No verified direct reference in this release
`At3g19050`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034
`At3g17360`	Involved in the spatial control of cytokinesis by a proper phragmoplast guidance.	Two kinesins are involved in the spatial control of cytokinesis in Arabidopsis thaliana.2006 · DOI: 10.1016/j.cub.2006.03.034 Tangled localization at the cortical division site of plant cells occurs by several mechanisms.2011 · DOI: 10.1242/jcs.073676

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q75LL2`	Kinesin-like protein KIN-12G.	No verified direct reference in this release
`Os12g0590500`	Kinesin-like protein KIN-12F.	No verified direct reference in this release
`Os07g0638000`	Kinesin-like protein KIN-12E.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014683 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000281 mitotic cytokinesis Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007018 microtubule-based movement Biological Process

GO:0051225 spindle assembly Biological Process

GO:0080175 phragmoplast microtubule organization Biological Process

GO:0005641 nuclear envelope lumen Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005819 spindle Cellular Component

GO:0005874 microtubule Cellular Component

GO:0009524 phragmoplast Cellular Component

GO:0032153 cell division site Cellular Component

GO:0003777 microtubule motor activity Molecular Function

KEGG gene cross-reference

ath:AT3G19050

ath:AT3G44050

dosa:Os03g0750200

dosa:Os07g0638000

dosa:Os12g0590500

osa:9269802

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.657

Rank 1 · TkA02G405040 · TK1151

Nucleus0.283

Rank 2 · TkA02G405040 · TK1151

Cell membrane0.128

Rank 3 · TkA02G405040 · TK1151

Golgi apparatus0.074

Rank 4 · TkA02G405040 · TK1151

Endoplasmic reticulum0.045

Rank 5 · TkA02G405040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16796Microtub_bd85-237 aa

PF00225Kinesin91-422 aa

PF00225Kinesin1064-1101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G405040	`PF16796`	Microtub_bd	85	237	3.8e-23	82.8
TkA02G405040	`PF00225`	Kinesin	91	422	4.9e-113	378.1
TkA02G405040	`PF00225`	Kinesin	1064	1101	4.9e-113	378.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4J1U4`	Arabidopsis thaliana	sp\|F4J1U4\|KN12E_ARATH Kinesin-like protein KIN-12E	53.600%	Swiss-Prot	High
`Q27IK6`	Arabidopsis thaliana	sp\|Q27IK6\|KN12D_ARATH Kinesin-like protein KIN-12D	55.200%	Swiss-Prot	Low
`Q27IK7`	Arabidopsis thaliana	sp\|Q27IK7\|KN12C_ARATH Kinesin-like protein KIN-12C	34.200%	Swiss-Prot	Low
`Q75LL2`	Oryza sativa subsp. japonica	sp\|Q75LL2\|KN12G_ORYSJ Kinesin-like protein KIN-12G	49.000%	Swiss-Prot	Medium
`B9GE13`	Oryza sativa subsp. japonica	sp\|B9GE13\|KN12F_ORYSJ Kinesin-like protein KIN-12F	55.600%	Swiss-Prot	Low
`B9FUF9`	Oryza sativa subsp. japonica	sp\|B9FUF9\|KN12E_ORYSJ Kinesin-like protein KIN-12E	53.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card