TkA02G402740 | RubberDandelionOmics

Gene overview

TkA02G402740

Reference: TK1151 Chr: Chr02 Coordinates: 102275227-102279184 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2245 bp · TkA02G402740|TK1151|cDNA

GTTACTGTTATGAACGTCTTCTCCTTTATGCAGATCTCCGACTCTGGTCAAGTGTCACTTTCCGGTGAAACTGCGGCAGCGACTGATCCAAAACAAGCTCACAGTTACTGTCTCCCAACACTTTCCCGATGGATGATTGGAATCCGGAGCAGCTATCTTCCTCCACCGCCGCCGCCGCCAAAGCACCAGAACCAACATCCATTTTCCAATCTTCTTATCAATACTGCTCGAGAATCTTACGCCAACGATTCATCGGCTGC...

CDS

Download CDS FASTA

1851 bp · TkA02G402740|TK1151|CDS

ATGGATGATTGGAATCCGGAGCAGCTATCTTCCTCCACCGCCGCCGCCGCCAAAGCACCAGAACCAACATCCATTTTCCAATCTTCTTATCAATACTGCTCGAGAATCTTACGCCAACGATTCATCGGCTGCATCCCTTCCTTGTCTAATTTAAATCTCCCGGAAAAGATCACGTTTCTCGAAAAGATTTCTACCCTCTACAAAAGACGAATCATCCCGTCCACATCACGAAGAAAGCGCGGCACGTGTCTCCCTCTTCC...

Protein

Download Protein FASTA

616 aa · TkA02G402740|TK1151|PROTEIN

MDDWNPEQLSSSTAAAAKAPEPTSIFQSSYQYCSRILRQRFIGCIPSLSNLNLPEKITFLEKISTLYKRRIIPSTSRRKRGTCLPLPLPSASFEPFTMTSETSRVYEVLGDIVEHIFFNLHSVQKNLHFWEARAEGSTSNKVYFMIFERGPLAFIDGSAQLLHDYVFHGTGMQQVSSSASVHISERISVLTSLRYSLATFLAQVYVEVDKSGEELLKEPGKSLASLLGTINGLFLSLEASIGHFSAMRQMGSSVDGSYSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G402740`
TK1151 ID	TkA02G402740
OH-1004 ID	LXL04_014718
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G402740

Location Chr02:102275227-102279184 (+)

Description Similar to DGS1: Protein DGS1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g12290`	Involved in galactoglycerolipid biosynthesis.	Mutation of a mitochondrial outer membrane protein affects chloroplast lipid biosynthesis.2008 · DOI: 10.1111/j.1365-313x.2008.03417.x Phosphate regulation of lipid biosynthesis in Arabidopsis is independent of the mitochondrial outer membrane DGS1 complex.2010 · DOI: 10.1104/pp.110.153262 Arabidopsis DGD1 SUPPRESSOR1 Is a Subunit of the Mitochondrial Contact Site and Cristae Organizing System and Affects Mitochondrial Biogenesis.2019 · DOI: 10.1105/tpc.18.00885

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014718 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007005 mitochondrion organization Biological Process

GO:0009060 aerobic respiration Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0016071 mRNA metabolic process Biological Process

GO:0019375 galactolipid biosynthetic process Biological Process

GO:0050665 hydrogen peroxide biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0032991 protein-containing complex Cellular Component

KEGG gene cross-reference

ago:AGOS_AFR321C

ath:AT5G12290

ddi:DDB_G0267648

sce:YPR155C

spo:2540670

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.732

Rank 1 · TkA02G402740 · TK1151

Cytoplasm0.096

Rank 2 · TkA02G402740 · TK1151

Plastid0.078

Rank 3 · TkA02G402740 · TK1151

Nucleus0.067

Rank 4 · TkA02G402740 · TK1151

Peroxisome0.067

Rank 5 · TkA02G402740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25064ARM_TT21_5th16-52 aa

PF08637NCA2334-607 aa

PF25064ARM_TT21_5th448-488 aa

PF24203Phage_ProQ_C_like513-598 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G402740	`PF25064`	ARM_TT21_5th	16	52	0.061	14.4
TkA02G402740	`PF08637`	NCA2	334	607	1.2e-72	245.3
TkA02G402740	`PF25064`	ARM_TT21_5th	448	488	0.061	14.4
TkA02G402740	`PF24203`	Phage_ProQ_C_like	513	598	0.12	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GUK1`	Arabidopsis thaliana	sp\|Q8GUK1\|DGS1_ARATH Protein DGS1, mitochondrial	57.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card