TkA02G397990 | RubberDandelionOmics

Gene overview

TkA02G397990

Reference: TK1151 Chr: Chr02 Coordinates: 101113527-101114767 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1182 bp · TkA02G397990|TK1151|cDNA

ATGGAGGCTGCTAATACGCTGTTTGGAAAAGTTACCGATTTGGTGTTTGGAGTGGTTAAACAGGAGATTGATTATATCCGGAATTGCAGTGAAAATGTTAACAAGTTGAGGGAGGAAACTCAAAATCTGAAAGATATGAAGGGCGTGGTTCAACAACGAATCGATGTAGCTAATGGTAAAGGAGATCATCTCTTAGATGGTGTAATAAAGTGGATCAATAAGGCGGAAACTGAAATATCCACGGCGGAGAAGTTAATTGA...

CDS

Download CDS FASTA

1182 bp · TkA02G397990|TK1151|CDS

ATGGAGGCTGCTAATACGCTGTTTGGAAAAGTTACCGATTTGGTGTTTGGAGTGGTTAAACAGGAGATTGATTATATCCGGAATTGCAGTGAAAATGTTAACAAGTTGAGGGAGGAAACTCAAAATCTGAAAGATATGAAGGGCGTGGTTCAACAACGAATCGATGTAGCTAATGGTAAAGGAGATCATCTCTTAGATGGTGTAATAAAGTGGATCAATAAGGCGGAAACTGAAATATCCACGGCGGAGAAGTTAATTGA...

Protein

Download Protein FASTA

393 aa · TkA02G397990|TK1151|PROTEIN

MEAANTLFGKVTDLVFGVVKQEIDYIRNCSENVNKLREETQNLKDMKGVVQQRIDVANGKGDHLLDGVIKWINKAETEISTAEKLIEEEANAKKTCFNSRLCLNLGTLHHYSKMAASTTRLLLEMNENGKTYENCVSIPAPTPSIGNHEALSDESIQLVGVYGLGGVGKTTLAKEVAAEVKNQFENIVFITVSQIIEAKVIQEKVQVAAKRIIKGDKVLIILDDIWVEIVLSDVGIPCWKDYKNCKILFTSRSKHVCETM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G397990`
TK1151 ID	TkA02G397990
OH-1004 ID	LXL04_014773
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	91.000
Protein coverage (%)	TK1151 96.947 / OH-1004 41.213 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G397990

Location Chr02:101113527-101114767 (+)

Description Similar to At4g27220: Probable disease resistance protein At4g27220

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g61180`	Involved in disease resistance via the salicylic acid (SA) signaling pathway.	No verified direct reference in this release
`At1g61190`	Probable disease resistance protein.	No verified direct reference in this release
`At1g61310`	Probable disease resistance protein.	No verified direct reference in this release
`At4g27190`	Disease resistance protein.	No verified direct reference in this release
`At4g10780`	Potential disease resistance protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014773 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002220 innate immune response activating cell surface receptor signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0009626 plant-type hypersensitive response Biological Process

GO:0016045 detection of bacterium Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0098542 defense response to other organism Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0043531 ADP binding Molecular Function

KEGG gene cross-reference

ath:AT1G61180

ath:AT4G26090

ath:AT4G27190

ath:AT4G27220

ath:AT5G47250

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.741

Rank 1 · TkA02G397990 · TK1151

Endoplasmic reticulum0.157

Rank 2 · TkA02G397990 · TK1151

Cytoplasm0.104

Rank 3 · TkA02G397990 · TK1151

Extracellular0.051

Rank 4 · TkA02G397990 · TK1151

Lysosome / Vacuole0.048

Rank 5 · TkA02G397990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09602PhaP_Bmeg11-81 aa

PF13238AAA_1817-69 aa

PF13173AAA_1422-43 aa

PF13207AAA_1730-74 aa

PF10046BLOC1_230-45 aa

PF01656CbiA30-59 aa

PF01926MMR_HSR142-48 aa

PF01637ATPase_264-89 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G397990	`PF09602`	PhaP_Bmeg	11	81	0.13	12.9
TkA02G397990	`PF13238`	AAA_18	17	69	0.039	15.1
TkA02G397990	`PF13173`	AAA_14	22	43	6.5e-06	26.9
TkA02G397990	`PF13207`	AAA_17	30	74	0.00053	21.0
TkA02G397990	`PF10046`	BLOC1_2	30	45	0.77	10.9
TkA02G397990	`PF01656`	CbiA	30	59	1.6	9.5
TkA02G397990	`PF01926`	MMR_HSR1	42	48	0.19	12.6
TkA02G397990	`PF01637`	ATPase_2	64	89	0.0012	19.4
TkA02G397990	`PF20720`	nSTAND3	77	95	0.026	14.9
TkA02G397990	`PF10046`	BLOC1_2	79	134	0.77	10.9
TkA02G397990	`PF00931`	NB-ARC	150	205	2.5e-27	96.3
TkA02G397990	`PF05970`	PIF1	151	193	0.062	13.6
TkA02G397990	`PF25199`	nSTAND_NTPase5	152	225	0.055	14.0
TkA02G397990	`PF01637`	ATPase_2	153	204	0.0012	19.4
TkA02G397990	`PF13604`	AAA_30	154	212	0.05	14.1
TkA02G397990	`PF05496`	RuvB_N	154	186	0.11	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q940K0`	Arabidopsis thaliana	sp\|Q940K0\|UNI_ARATH Disease resistance protein UNI	29.800%	Swiss-Prot	Low
`O22727`	Arabidopsis thaliana	sp\|O22727\|DRL16_ARATH Probable disease resistance protein At1g61190	30.000%	Swiss-Prot	Medium
`O64789`	Arabidopsis thaliana	sp\|O64789\|DRL18_ARATH Probable disease resistance protein At1g61310	29.800%	Swiss-Prot	Low
`Q9T048`	Arabidopsis thaliana	sp\|Q9T048\|DRL27_ARATH Disease resistance protein At4g27190	29.800%	Swiss-Prot	Low
`O82484`	Arabidopsis thaliana	sp\|O82484\|DRL23_ARATH Putative disease resistance protein At4g10780	29.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card