TkA02G397830 | RubberDandelionOmics

Gene overview

TkA02G397830

Reference: TK1151 Chr: Chr02 Coordinates: 101074536-101077289 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1470 bp · TkA02G397830|TK1151|cDNA

ATGGAGGATCCTAAGAGGGTGGAAGAAGGGTTCGGTCATGGTCAGATATCTCCAGCCGAAAAAGTTGAAAGAGAAGACATGGGAGAGAGGAGTGAAATGACAACTGAACAACATCACCAAACCAAGGTTGCTGAAACCCCGGTGTTGGTCAAAGAAAAGAGTAAAAGGATTGCGACTTTGGATGCATTCCGTGGTCTTACGATTGTACTAATGATATTAGTAGATGATGCTGGAGGTGTATACGAACGGATAGATCATTC...

CDS

Download CDS FASTA

1470 bp · TkA02G397830|TK1151|CDS

ATGGAGGATCCTAAGAGGGTGGAAGAAGGGTTCGGTCATGGTCAGATATCTCCAGCCGAAAAAGTTGAAAGAGAAGACATGGGAGAGAGGAGTGAAATGACAACTGAACAACATCACCAAACCAAGGTTGCTGAAACCCCGGTGTTGGTCAAAGAAAAGAGTAAAAGGATTGCGACTTTGGATGCATTCCGTGGTCTTACGATTGTACTAATGATATTAGTAGATGATGCTGGAGGTGTATACGAACGGATAGATCATTC...

Protein

Download Protein FASTA

489 aa · TkA02G397830|TK1151|PROTEIN

MEDPKRVEEGFGHGQISPAEKVEREDMGERSEMTTEQHHQTKVAETPVLVKEKSKRIATLDAFRGLTIVLMILVDDAGGVYERIDHSPWNGCTLADFVMPFFLFIVGVAIALALKRVPSRRFAVRKIIIRTLKMLFWGILLQGGYSHAPDELVYGVDMKKIRWCGILQRIALVYMIVALIETLTTKLRPTAIDPGHFSIFSAYRWQWLGGFIAFLIYIITTFALYVPDWSFTVQEDDKSQSFTVKCGMRGHLGPACNAVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G397830`
TK1151 ID	TkA02G397830
OH-1004 ID	LXL04_014776
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G397830`
Location	Chr02:101074536-101077289 (-)
Description	Similar to Hgsnat: Heparan-alpha-glucosaminide N-acetyltransferase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014776` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007041 lysosomal transport Biological Process GO:0030200 heparan sulfate proteoglycan catabolic process Biological Process GO:0051259 protein complex oligomerization Biological Process GO:0005765 lysosomal membrane Cellular Component GO:0005886 plasma membrane Cellular Component GO:0043202 lysosomal lumen Cellular Component GO:0070821 tertiary granule membrane Cellular Component GO:0015019 heparan-alpha-glucosaminide N-acetyltransferase activity Molecular Function GO:0016746 acyltransferase activity Molecular Function
KEGG gene cross-reference	hsa:138050 mmu:52120 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.322

Rank 1 · TkA02G397830 · TK1151

Endoplasmic reticulum0.228

Rank 2 · TkA02G397830 · TK1151

Cytoplasm0.208

Rank 3 · TkA02G397830 · TK1151

Lysosome / Vacuole0.200

Rank 4 · TkA02G397830 · TK1151

Cell membrane0.193

Rank 5 · TkA02G397830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07786HGSNAT_cat56-185 aa

PF01757Acyl_transf_358-419 aa

PF16401DUF500989-129 aa

PF07786HGSNAT_cat340-360 aa

PF16401DUF5009341-375 aa

PF16401DUF5009413-435 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G397830	`PF07786`	HGSNAT_cat	56	185	2.2e-07	31.4
TkA02G397830	`PF01757`	Acyl_transf_3	58	419	0.0088	15.9
TkA02G397830	`PF16401`	DUF5009	89	129	0.0014	18.8
TkA02G397830	`PF07786`	HGSNAT_cat	340	360	2.2e-07	31.4
TkA02G397830	`PF16401`	DUF5009	341	375	0.0014	18.8
TkA02G397830	`PF16401`	DUF5009	413	435	0.0014	18.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card