TkA02G396470 | RubberDandelionOmics

Gene overview

TkA02G396470

Reference: TK1151 Chr: Chr02 Coordinates: 100652510-100654875 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1247 bp · TkA02G396470|TK1151|cDNA

TGGCACCGTTGTGTATTGTTTCTGGCTTCAGTCACTCAAATATTTCCTAGGGATTTCGCGATCTCAGGTGAAACATCTTCCCGGTTTGATCAATTCTATCGTTCGTGCACTTTAAAAAATGTTGAAAATTTAGGGTTTCACAGCTTGATGGAGGCTCTCTATTCCAAACTGTATGATAAATACACCAGGCTCAAGGCAACTAAGACTCTTGACATAGAGCAGTACAATTTCGACCAAGAACAAAAATTTAAGATTTACGT...

CDS

Download CDS FASTA

1008 bp · TkA02G396470|TK1151|CDS

TGGCACCGTTGTGTATTGTTTCTGGCTTCAGTCACTCAAATATTTCCTAGGGATTTCGCGATCTCAGGTGAAACATCTTCCCGGTTTGATCAATTCTATCGTTCGTGCACTTTAAAAAATGTTGAAAATTTAGGGTTTCACAGCTTGATGGAGGCTCTCTATTCCAAACTGTATGATAAATACACCAGGCTCAAGGCAACTAAGACTCTTGACATAGAGCAGTACAATTTCGACCAAGAACAAAAATTTAAGATTTACGT...

Protein

Download Protein FASTA

335 aa · TkA02G396470|TK1151|PROTEIN

WHRCVLFLASVTQIFPRDFAISGETSSRFDQFYRSCTLKNVENLGFHSLMEALYSKLYDKYTRLKATKTLDIEQYNFDQEQKFKIYVSAADELIGYLKNEKDILDAQVIELRHELATIRSAKEEEQAKYEHIISKENLKVKELSEEIQRLNRKESHPSPSNEIVPINQVSNSPISSSKSKTKRKRHTSSINEQENSFSQEPQNTLEKENTFSSTPIDNANQPKCCRRRLSNSVNGSESSMCMFQELVECILDLKFSVATQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G396470`
TK1151 ID	TkA02G396470
OH-1004 ID	LXL04_014798
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.900
Protein coverage (%)	TK1151 100.000 / OH-1004 81.368 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G396470`
Location	Chr02:100652510-100654875 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014798` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.896

Rank 1 · TkA02G396470 · TK1151

Cytoplasm0.198

Rank 2 · TkA02G396470 · TK1151

Cell membrane0.023

Rank 3 · TkA02G396470 · TK1151

Mitochondrion0.018

Rank 4 · TkA02G396470 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA02G396470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28907ZapB_rel51-72 aa

PF19786DUF627067-151 aa

PF28907ZapB_rel97-131 aa

PF28869LMNTD2_N99-153 aa

PF28907ZapB_rel133-153 aa

PF17213Hydin_ADK140-240 aa

PF25091DUF7806239-331 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G396470	`PF28907`	ZapB_rel	51	72	1.8	9.9
TkA02G396470	`PF19786`	DUF6270	67	151	0.24	12.0
TkA02G396470	`PF28907`	ZapB_rel	97	131	1.8	9.9
TkA02G396470	`PF28869`	LMNTD2_N	99	153	0.025	15.8
TkA02G396470	`PF28907`	ZapB_rel	133	153	1.8	9.9
TkA02G396470	`PF17213`	Hydin_ADK	140	240	0.28	12.0
TkA02G396470	`PF25091`	DUF7806	239	331	3.9e-38	130.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card