TkA02G392030 | RubberDandelionOmics

Gene overview

TkA02G392030

Reference: TK1151 Chr: Chr02 Coordinates: 99632310-99633164 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

855 bp · TkA02G392030|TK1151|cDNA

TTTCTTGTTTTCTTCTTCTTTTACTCTTCTTCTTCTTCCCAAAAAACTTGCCCCAATTGTGGTCTCCAAAATCTCCCATACCCATTAAGCACCAACCCCAATTGTGGCAACACCGACTACACTCTTAAATGCCATAATCAAAAACTATACTTCAATGCCTTGAATGGAACTTCATATCTTGTCCTCAAAATCAACCCCACAACCCAAAAACTAGTAATCCAAACTCAACCATGGTTAAATGAACAATGCATCACCCGCGA...

CDS

Download CDS FASTA

855 bp · TkA02G392030|TK1151|CDS

TTTCTTGTTTTCTTCTTCTTTTACTCTTCTTCTTCTTCCCAAAAAACTTGCCCCAATTGTGGTCTCCAAAATCTCCCATACCCATTAAGCACCAACCCCAATTGTGGCAACACCGACTACACTCTTAAATGCCATAATCAAAAACTATACTTCAATGCCTTGAATGGAACTTCATATCTTGTCCTCAAAATCAACCCCACAACCCAAAAACTAGTAATCCAAACTCAACCATGGTTAAATGAACAATGCATCACCCGCGA...

Protein

Download Protein FASTA

284 aa · TkA02G392030|TK1151|PROTEIN

FLVFFFFYSSSSSQKTCPNCGLQNLPYPLSTNPNCGNTDYTLKCHNQKLYFNALNGTSYLVLKINPTTQKLVIQTQPWLNEQCITRDFPVSEGLWLNQSLPFNITSQNTIFIFNCSPRLLVSPLNCTRSSLCHQYLENSGRVDPERALQCANTINPCCTFIAGGLPSAYKIRLHASGCRAFKSIINLEKEKSAKECEEGLEIQWAPPPVPVCKTQTDCSGESKCETTEKGISRCICNRHYYWDYALGICSKKGISKTEFP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G392030`
TK1151 ID	TkA02G392030
OH-1004 ID	LXL04_014850
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	97.200
Protein coverage (%)	TK1151 100.000 / OH-1004 45.513 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G392030

Location Chr02:99632310-99633164 (+)

Description Similar to WAKL20: Wall-associated receptor kinase-like 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g02070`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014850 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0009603 detection of symbiotic fungus Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0034052 positive regulation of plant-type hypersensitive response Biological Process

GO:0045087 innate immune response Biological Process

GO:0048527 lateral root development Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009897 external side of plasma membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G21210

ath:AT1G69730

ath:AT3G53840

ath:AT5G02070

zma:103645992

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.821

Rank 1 · TkA02G392030 · TK1151

Cytoplasm0.084

Rank 2 · TkA02G392030 · TK1151

Extracellular0.078

Rank 3 · TkA02G392030 · TK1151

Endoplasmic reticulum0.072

Rank 4 · TkA02G392030 · TK1151

Nucleus0.048

Rank 5 · TkA02G392030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947GUB_WAK_bind17-73 aa

PF13947GUB_WAK_bind134-134 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G392030	`PF13947`	GUB_WAK_bind	17	73	8.2e-09	36.4
TkA02G392030	`PF13947`	GUB_WAK_bind	134	134	8.2e-09	36.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LZM4`	Arabidopsis thaliana	sp\|Q9LZM4\|WAKLQ_ARATH Wall-associated receptor kinase-like 20	41.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card