TkA02G384910 | RubberDandelionOmics

Gene overview

TkA02G384910

Reference: TK1151 Chr: Chr02 Coordinates: 97828125-97830352 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1614 bp · TkA02G384910|TK1151|cDNA

AAAAAAAAAGAAATAATGGAGAACCAAAATGGTGAAAAATGAATGAAAACCGCCTTGGAAAGCGGTTTTTCAAAACCGCCAACAAGAAAAAAAAGCGACTAGTCCGATCTCCGCCTCTTTAAATATAAACCCTTAAACCTGCGCATACTCGTGTATCATTTCCTCTCTCTACCTTCACCAAAAATCCCCCAACTTCAAATCTTACGATCATGTCTTGCTACAAGGGAAAGTATGCTGATGAACTTATCGCCAACGCTACC...

CDS

Download CDS FASTA

690 bp · TkA02G384910|TK1151|CDS

ATGCGCCCAGTACTACTCCGCCGGCGCCAGGTTCGCAAAATGGCGTGCGGTTCTCAAAATCGGCCCAAACGAACCATCCCAGCTCGCCATCAACGAAAACGCCAACGGCTTAGCCAGGTTAGCGCCATCATCTGTCAGGAAAACGGTCTAGTCCCAATCGTCGAACCAGAAATCCTCGTCGACGGACCTCACGACATCAAAAAATGTGCTGACGTCACCGAACGTGTCCTCGCCGCCTGCTACAAAGCCCTCAACGACCA...

Protein

Download Protein FASTA

229 aa · TkA02G384910|TK1151|PROTEIN

MRPVLLRRRQVRKMACGSQNRPKRTIPARHQRKRQRLSQVSAIICQENGLVPIVEPEILVDGPHDIKKCADVTERVLAACYKALNDHHVLLEGTLLKPNMVTPGSDAKKVAPEVVAEYTVTALQRTMPAAVPAVVFLSGGQSEEQATVNLNAINQFKGKKPWSLTFSFGRALQQSTLKAWGGKEENVKKAQEAFLARCKANSEATLGKYQGGAALDGASESLHVKDYKY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G384910`
TK1151 ID	TkA02G384910
OH-1004 ID	LXL04_014907
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 82.096 / OH-1004 52.661 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G384910

Location Chr02:97828125-97830352 (-)

Description Similar to FBA6: Fructose-bisphosphate aldolase 6, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36460`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	Regulation of plant cytosolic aldolase functions by redox-modifications.2011 · DOI: 10.1016/j.plaphy.2011.06.009 Transfer of a Redox-Signal through the Cytosol by Redox-Dependent Microcompartmentation of Glycolytic Enzymes at Mitochondria and Actin Cytoskeleton.2012 · DOI: 10.3389/fpls.2012.00284
`At5g03690`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release
`At3g52930`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0905800`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis.	No verified direct reference in this release
`Os05g0402700`	Fructose-bisphosphate aldolase that plays a key role in glycolysis and gluconeogenesis (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014907 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0030388 fructose 1,6-bisphosphate metabolic process Biological Process

GO:0031930 mitochondria-nucleus signaling pathway Biological Process

GO:0048364 root development Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT2G36460

cam:101501462

dosa:Os01g0905800

dosa:Os05g0402700

osa:4338737

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.432

Rank 1 · TkA02G384910 · TK1151

Mitochondrion0.252

Rank 2 · TkA02G384910 · TK1151

Peroxisome0.186

Rank 3 · TkA02G384910 · TK1151

Nucleus0.185

Rank 4 · TkA02G384910 · TK1151

Extracellular0.110

Rank 5 · TkA02G384910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00274Glycolytic42-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G384910	`PF00274`	Glycolytic	42	229	3.4e-92	309.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJQ9`	Arabidopsis thaliana	sp\|Q9SJQ9\|ALFC6_ARATH Fructose-bisphosphate aldolase 6, cytosolic	85.200%	Swiss-Prot	High
`F4KGQ0`	Arabidopsis thaliana	sp\|F4KGQ0\|ALFC4_ARATH Fructose-bisphosphate aldolase 4, cytosolic	85.800%	Swiss-Prot	High
`Q9LF98`	Arabidopsis thaliana	sp\|Q9LF98\|ALFC8_ARATH Fructose-bisphosphate aldolase 8, cytosolic	83.600%	Swiss-Prot	High
`Q5N725`	Oryza sativa subsp. japonica	sp\|Q5N725\|ALFC3_ORYSJ Fructose-bisphosphate aldolase 3, cytoplasmic	82.000%	Swiss-Prot	High
`P17784`	Oryza sativa subsp. japonica	sp\|P17784\|ALFC1_ORYSJ Fructose-bisphosphate aldolase 1, cytoplasmic	82.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card