TkA02G360020 | RubberDandelionOmics

Gene overview

TkA02G360020

Reference: TK1151 Chr: Chr02 Coordinates: 91496335-91504144 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

4206 bp · TkA02G360020|TK1151|CDS

ATGGCAAATGCGATGAACAGAAATAGACGACGAGACACCAACCTCGCATTCACCAAACAACCTTATATCGAAGATGTTGGTCCTCGTAGGATCAAGAACATCAAATTCTCAACGTTGTCTCGCGAGGATGTTCTTAAAATGGGGGAAGTTCAGGTTACTCGTTCCCAATATTATGTGAGTCAAGCCGACAAAACGCCTGCTGCCAATGGCGTGTTAGATGCGCACATGGGTCCTCCAAACAGGTGTGGTACATGTGAGAC...

Protein

Download Protein FASTA

1401 aa · TkA02G360020|TK1151|PROTEIN

MANAMNRNRRRDTNLAFTKQPYIEDVGPRRIKNIKFSTLSREDVLKMGEVQVTRSQYYVSQADKTPAANGVLDAHMGPPNRCGTCETCHGEFQICPGHFGYLPLALPVYNVGYMSHVVDILKCICKFCSRILLLEEERLTFLKKMRNPNNDHMKKNGIYKMVVKRCTAMASSKRALTCSRCNSTNGVVKKAVGAVGVIHDRNKVQDTTSKGLKGDLKTPGKLSSLINPDKALKLFKKMLDEDCELLYLADRPENLIISII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G360020`
TK1151 ID	TkA02G360020
OH-1004 ID	LXL04_015154
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G360020

Location Chr02:91496335-91504144 (+)

Description Similar to NRPC1: DNA-directed RNA polymerase III subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60040`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015154 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006383 transcription by RNA polymerase III Biological Process

GO:0006384 transcription initiation at RNA polymerase III promoter Biological Process

GO:0006386 termination of RNA polymerase III transcription Biological Process

GO:0032728 positive regulation of interferon-beta production Biological Process

GO:0042797 tRNA transcription by RNA polymerase III Biological Process

GO:0045087 innate immune response Biological Process

GO:0051607 defense response to virus Biological Process

GO:0000428 DNA-directed RNA polymerase complex Cellular Component

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT5G60040

bta:540308

dha:DEHA2G12980g

sce:YOR116C

spo:2541094

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.905

Rank 1 · TkA02G360020 · TK1151

Cytoplasm0.139

Rank 2 · TkA02G360020 · TK1151

Mitochondrion0.025

Rank 3 · TkA02G360020 · TK1151

Cell membrane0.023

Rank 4 · TkA02G360020 · TK1151

Endoplasmic reticulum0.011

Rank 5 · TkA02G360020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04997RNA_pol_Rpb1_129-359 aa

PF05000RNA_pol_Rpb1_4135-162 aa

PF01247Ribosomal_L35Ae157-201 aa

PF10058Zn_ribbon_10170-189 aa

PF01247Ribosomal_L35Ae333-364 aa

PF00623RNA_pol_Rpb1_2361-527 aa

PF04983RNA_pol_Rpb1_3530-708 aa

PF05000RNA_pol_Rpb1_4737-839 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G360020	`PF04997`	RNA_pol_Rpb1_1	29	359	2e-68	231.8
TkA02G360020	`PF05000`	RNA_pol_Rpb1_4	135	162	2.1e-32	111.9
TkA02G360020	`PF01247`	Ribosomal_L35Ae	157	201	0.8	10.6
TkA02G360020	`PF10058`	Zn_ribbon_10	170	189	0.026	15.0
TkA02G360020	`PF01247`	Ribosomal_L35Ae	333	364	0.8	10.6
TkA02G360020	`PF00623`	RNA_pol_Rpb1_2	361	527	1.8e-69	234.0
TkA02G360020	`PF04983`	RNA_pol_Rpb1_3	530	708	1.9e-38	132.6
TkA02G360020	`PF05000`	RNA_pol_Rpb1_4	737	839	2.1e-32	111.9
TkA02G360020	`PF04998`	RNA_pol_Rpb1_5	779	810	1.5e-86	290.9
TkA02G360020	`PF04998`	RNA_pol_Rpb1_5	846	1331	1.5e-86	290.9
TkA02G360020	`PF27033`	DUF8340	1166	1236	0.19	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JXF9`	Arabidopsis thaliana	sp\|F4JXF9\|NRPC1_ARATH DNA-directed RNA polymerase III subunit 1	58.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card