TkA02G358930 | RubberDandelionOmics

Gene overview

TkA02G358930

Reference: TK1151 Chr: Chr02 Coordinates: 91188933-91191497 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1165 bp · TkA02G358930|TK1151|cDNA

CTCAGAACAAGGCATATTCTCGATCCACTCACCTTACCAAGGGCACTTCTGTCTTTTCGCCAATTTGTGATCCACAAAATCGATATAAATAAGCGACTCTATCTGTGATCTGCTTTGGACTTTACCTAATCTCATCTTTTTCGAGTTTTCTTTCTCTGCAAGTAGCGTTTTTTTTGATCGAAGATGGGTCGCAAGTTTTTCGTCGGTGGTAACTGGAAATGCAATGGAACAACCGAGGATGTGAAAAAGATTGTGGCAAC...

CDS

Download CDS FASTA

519 bp · TkA02G358930|TK1151|CDS

ATGCTTGCCAATTTGGGCGTCCCATGGGTCATCCTAGGTCATTCTGAAAGGAGAGCCCTATTAAATGAAACCAATGAGTTTGTTGGAGAGAAGGTAGCATACGCCCTTTCTCAAGGTCTCAAGGTTATCGCTTGTGTTGGTGAAACCCTAGAACAGCGAGAAGCGGGGACCACCATGGAAGTTGTGGCTGCACAAACCAAGGCAATTGCTGATAAAATCTCAAGCTGGGATAACGTTGTTTTGGCTTATGAGCCAGTGTG...

Protein

Download Protein FASTA

172 aa · TkA02G358930|TK1151|PROTEIN

MLANLGVPWVILGHSERRALLNETNEFVGEKVAYALSQGLKVIACVGETLEQREAGTTMEVVAAQTKAIADKISSWDNVVLAYEPVWAIGTGKVASPAQAQEVHAGLRKWFCDNVSAEVSASTRIIYGGSVSGSNCKELGGQTDVDGFLVGGASLKPEFIDIIKAAEVKKSA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G358930`
TK1151 ID	TkA02G358930
OH-1004 ID	LXL04_022273
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	86.500
Protein coverage (%)	TK1151 98.837 / OH-1004 67.460 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G358930

Location Chr02:91188933-91191497 (-)

Description Similar to TPIP1: Triosephosphate isomerase, cytosolic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g55440`	Triosephosphate isomerase, cytosolic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022273 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006094 gluconeogenesis Biological Process

GO:0006096 glycolytic process Biological Process

GO:0010043 response to zinc ion Biological Process

GO:0019563 glycerol catabolic process Biological Process

GO:0046166 glyceraldehyde-3-phosphate biosynthetic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

KEGG gene cross-reference

ath:AT3G55440

dosa:Os01g0147900

zma:100272481

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.707

Rank 1 · TkA02G358930 · TK1151

Nucleus0.334

Rank 2 · TkA02G358930 · TK1151

Mitochondrion0.157

Rank 3 · TkA02G358930 · TK1151

Cell membrane0.123

Rank 4 · TkA02G358930 · TK1151

Endoplasmic reticulum0.090

Rank 5 · TkA02G358930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00121TIM1-166 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G358930	`PF00121`	TIM	1	166	4.4e-64	217.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P48491`	Arabidopsis thaliana	sp\|P48491\|TPIS_ARATH Triosephosphate isomerase, cytosolic	83.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card