TkA02G351720 | RubberDandelionOmics

Gene overview

TkA02G351720

Reference: TK1151 Chr: Chr02 Coordinates: 89448538-89451687 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1961 bp · TkA02G351720|TK1151|cDNA

AAAAACACACAGAATGGAAATAATTCAACACTTGCCCTCGTTTGAACGACGCCTCCTGCATTACCTTTGCCTAGACGACGCAGTACTCCATCGCAACTTCTTCCATCGCTCTCTATTCCGGCGGCGCCGTCTTCTTTCACCTCCGTCCTATCCAGCGGCGCCGTAGTCCTCCCCCTTCTCTGCCACCATCGAAATTATAGGTCAATGTGAAATCCATTTTCGTCACCCACAATCGATTTTTTAGGCGGTGTTATAGATGA...

CDS

Download CDS FASTA

1440 bp · TkA02G351720|TK1151|CDS

ATGAGTCGCATTGATGATTCACCGGTGAACTCATCAAGCAGCGATGATTTTGCCGCATTTCTGGATGCTGAGCTAGATTCTGTTTCTGATAGTTCCCCTCAATCAGAAGAAGAAGAAGTAGAAGAAGAAGAGGAACAAGAAGAAGAAGAAGAAGTAGCAGAAGAGGAAGACAACGAAGATGATGATGGTGATGGTGAGAATTGTAAGTATCCTATTGAAAGGACTAAAAGGAGGAAGATCAGTTTTTCTGAAAGTACCCA...

Protein

Download Protein FASTA

479 aa · TkA02G351720|TK1151|PROTEIN

MSRIDDSPVNSSSSDDFAAFLDAELDSVSDSSPQSEEEEVEEEEEQEEEEEVAEEEDNEDDDGDGENCKYPIERTKRRKISFSESTQEPNGSTSHTEQEIILESVKEVICAHPGFIGGMCIKCGEKMDTDNRSGVAFGYIHKDLRLANDEIARLRDRDLKNLLRHKKLYLVLDLDHTLLNSSRMSDIIQEEGYLMNQNDPVQDALKDSLFKLPSMHMVTKLRPFVRTFLKEASKLFEMYIYTMGERSYALEMANLLDPGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G351720`
TK1151 ID	TkA02G351720
OH-1004 ID	LXL04_015253
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G351720

Location Chr02:89448538-89451687 (+)

Description Similar to CPL4: RNA polymerase II C-terminal domain phosphatase-like 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g58003`	Processively dephosphorylates 'Ser-2' and/or 'Ser-5' of the heptad repeats YSPTSPS in the C-terminal domain of the largest RNA polymerase II subunit (RPB1).	Arabidopsis carboxyl-terminal domain phosphatase-like isoforms share common catalytic and interaction domains but have distinct in planta functions.2006 · DOI: 10.1104/pp.106.084939
`At2g33540`	Completely dephosphorylates 'Ser-2', and partially 'Ser-5' and 'Ser-7' of the heptad repeats YSPTSPS in the C-terminal domain (CTD) of the largest RNA polymerase II subunit (RPB1).	C-terminal domain phosphatase-like family members (AtCPLs) differentially regulate Arabidopsis thaliana abiotic stress signaling, growth, and development.2002 · DOI: 10.1073/pnas.112276199 Arabidopsis carboxyl-terminal domain phosphatase-like isoforms share common catalytic and interaction domains but have distinct in planta functions.2006 · DOI: 10.1104/pp.106.084939 Modulation of RNA polymerase II phosphorylation downstream of pathogen perception orchestrates plant immunity.2014 · DOI: 10.1016/j.chom.2014.10.018 A genetics screen highlights emerging roles for CPL3, RST1 and URT1 in RNA metabolism and silencing.2019 · DOI: 10.1038/s41477-019-0419-7
`At3g19600`	Mediates the dephosphorylation of 'Ser-2' of the heptad repeats YSPTSPS in the C-terminal domain of the largest RNA polymerase II subunit (RPB1).	AtCPL5, a novel Ser-2-specific RNA polymerase II C-terminal domain phosphatase, positively regulates ABA and drought responses in Arabidopsis.2011 · DOI: 10.1111/j.1469-8137.2010.03601.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015253 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:1900369 negative regulation of post-transcriptional gene silencing by regulatory ncRNA Biological Process

GO:1902074 response to salt Biological Process

GO:2000028 regulation of photoperiodism, flowering Biological Process

KEGG gene cross-reference

ath:AT2G33540

ath:AT3G19595

ath:AT3G19600

ath:AT5G58003

cel:CELE_F36F2.6

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.776

Rank 1 · TkA02G351720 · TK1151

Cytoplasm0.273

Rank 2 · TkA02G351720 · TK1151

Cell membrane0.057

Rank 3 · TkA02G351720 · TK1151

Endoplasmic reticulum0.034

Rank 4 · TkA02G351720 · TK1151

Mitochondrion0.021

Rank 5 · TkA02G351720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02724CDC4517-73 aa

PF29089Protamine-326-56 aa

PF17980ADD_DNMT3106-126 aa

PF03031NIF169-319 aa

PF00533BRCT382-456 aa

PF12738PTCB-BRCT403-454 aa

PF29089Protamine-3436-457 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G351720	`PF02724`	CDC45	17	73	1.2	8.0
TkA02G351720	`PF29089`	Protamine-3	26	56	1.5	9.8
TkA02G351720	`PF17980`	ADD_DNMT3	106	126	0.0056	17.3
TkA02G351720	`PF03031`	NIF	169	319	4.5e-26	92.2
TkA02G351720	`PF00533`	BRCT	382	456	1.1e-06	29.4
TkA02G351720	`PF12738`	PTCB-BRCT	403	454	0.00014	22.5
TkA02G351720	`PF29089`	Protamine-3	436	457	1.5	9.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q00IB6`	Arabidopsis thaliana	sp\|Q00IB6\|CPL4_ARATH RNA polymerase II C-terminal domain phosphatase-like 4	56.500%	Swiss-Prot	High
`Q8LL04`	Arabidopsis thaliana	sp\|Q8LL04\|CPL3_ARATH RNA polymerase II C-terminal domain phosphatase-like 3	39.800%	Swiss-Prot	Medium
`F4JCB2`	Arabidopsis thaliana	sp\|F4JCB2\|CPL5_ARATH RNA polymerase II C-terminal domain phosphatase-like 5	38.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card