TkA02G325220 | RubberDandelionOmics

Gene overview

TkA02G325220

Reference: TK1151 Chr: Chr02 Coordinates: 82519103-82520381 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

606 bp · TkA02G325220|TK1151|cDNA

CTTAACAATCAAACAACCATACAGGGAGAAAGAAGACTCTCAGTTCTTGCCGGTTATTTCATAGTCTTTATCCTTCATGTAATTGGAGTCTACTGGTGGTACCAAAATGATGATCTTTGTTATTCACTCTTCCTGGTTCCACTAAGAGCAATTCCACCATTCTGGCATGCTATATTCACCATCCTTGTGAATGATACAATGGTGAGACAGACAGCATTGGCTTTTAAGCTTGGTCAAATGTTGACTGTGATCGAGTACGC...

CDS

Download CDS FASTA

606 bp · TkA02G325220|TK1151|CDS

CTTAACAATCAAACAACCATACAGGGAGAAAGAAGACTCTCAGTTCTTGCCGGTTATTTCATAGTCTTTATCCTTCATGTAATTGGAGTCTACTGGTGGTACCAAAATGATGATCTTTGTTATTCACTCTTCCTGGTTCCACTAAGAGCAATTCCACCATTCTGGCATGCTATATTCACCATCCTTGTGAATGATACAATGGTGAGACAGACAGCATTGGCTTTTAAGCTTGGTCAAATGTTGACTGTGATCGAGTACGC...

Protein

Download Protein FASTA

201 aa · TkA02G325220|TK1151|PROTEIN

LNNQTTIQGERRLSVLAGYFIVFILHVIGVYWWYQNDDLCYSLFLVPLRAIPPFWHAIFTILVNDTMVRQTALAFKLGQMLTVIEYALLLYRAFLPAPVWYRFFLNKEYGSLFSSLTTGLYLTFKHTSIVEKVRSFWTSLKALLRKEVHYGSYVTPDQVIEAGDMCAICQEKMQAPILLRCKHISVKIVFRRTDEFRFSWL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G325220`
TK1151 ID	TkA02G325220
OH-1004 ID	LXL04_010090
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.600
Protein coverage (%)	TK1151 91.542 / OH-1004 81.057 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G325220`
Location	Chr02:82519103-82520381 (-)
Description	Similar to RNFT2: RING finger and transmembrane domain-containing protein 2
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_010090` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016567 protein ubiquitination Biological Process GO:0051865 protein autoubiquitination Biological Process GO:1904294 positive regulation of ERAD pathway Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0016020 membrane Cellular Component GO:0008270 zinc ion binding Molecular Function GO:0043130 ubiquitin binding Molecular Function GO:0061630 ubiquitin protein ligase activity Molecular Function
KEGG gene cross-reference	dre:406509 hsa:51136 hsa:84900 mmu:269695 pon:100174460 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.621

Rank 1 · TkA02G325220 · TK1151

Nucleus0.209

Rank 2 · TkA02G325220 · TK1151

Golgi apparatus0.128

Rank 3 · TkA02G325220 · TK1151

Cytoplasm0.121

Rank 4 · TkA02G325220 · TK1151

Cell membrane0.090

Rank 5 · TkA02G325220 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13920zf-C3HC4_3164-184 aa

PF13639zf-RING_2164-184 aa

PF13923zf-C3HC4_2165-184 aa

PF13445zf-RING_UBOX166-184 aa

PF00097zf-C3HC4166-183 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G325220	`PF13920`	zf-C3HC4_3	164	184	0.0055	17.2
TkA02G325220	`PF13639`	zf-RING_2	164	184	0.25	12.3
TkA02G325220	`PF13923`	zf-C3HC4_2	165	184	0.06	13.9
TkA02G325220	`PF13445`	zf-RING_UBOX	166	184	0.055	14.2
TkA02G325220	`PF00097`	zf-C3HC4	166	183	0.071	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card