TkA02G309410 | RubberDandelionOmics

Gene overview

TkA02G309410

Reference: TK1151 Chr: Chr02 Coordinates: 78746570-78749826 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1842 bp · TkA02G309410|TK1151|cDNA

GACCACCGAACACTAAAACATAGCCTTTATATGAAACGGCCACGCCACCTCATCTCTCCGTTTCTGTGCACAGCACACACAACACCAGAACTCCGACTCAAATTCAATGGATTCAAATCTGTGTGCATTGCTGCAAAGTTCCCCTTACTCTCCCTCAATCTTCTTCGGTTCATCTAAACCTAATCTGCAAATCATGCAATCACCTGGTGATCAGCTGAGTATTCCGAGGCTCAAATTCGAGGGCAATCGTCGTTTATCTG...

CDS

Download CDS FASTA

1503 bp · TkA02G309410|TK1151|CDS

ATGGATTCAAATCTGTGTGCATTGCTGCAAAGTTCCCCTTACTCTCCCTCAATCTTCTTCGGTTCATCTAAACCTAATCTGCAAATCATGCAATCACCTGGTGATCAGCTGAGTATTCCGAGGCTCAAATTCGAGGGCAATCGTCGTTTATCTGTTGTAAAATCGATGTCGAAAGCCGAAATTTACGATTCTGGTGGTGTGGAGGTTAAAGCAACAGAAGACGTTAAGGAGATTGTGAATCCGCTTTATGTGCCCACGCC...

Protein

Download Protein FASTA

500 aa · TkA02G309410|TK1151|PROTEIN

MDSNLCALLQSSPYSPSIFFGSSKPNLQIMQSPGDQLSIPRLKFEGNRRLSVVKSMSKAEIYDSGGVEVKATEDVKEIVNPLYVPTPSNRPLRTPHSGYHFDGTTRKFFEGWYFKVSIPERRQNFCFMYSVENPAFRKPLNGLEQLQYGQRFTGVGAQILGADDEYICQYTEESQNFWGSRHELKLGNSFTMQKGKKPPSNEVSPQVFNQSVVEGFQVTPLWNQGFIRDDGRTPYAKTVKTARWEYSTRPIYGWGNVGST...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G309410`
TK1151 ID	TkA02G309410
OH-1004 ID	LXL04_015609
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G309410

Location Chr02:78746570-78749826 (+)

Description Similar to VTE1: Tocopherol cyclase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g32770`	Involved in the synthesis of both tocopherols and tocotrienols (vitamin E), which presumably protect photosynthetic complexes from oxidative stress.	Isolation of an Arabidopsis mutant lacking vitamin E and identification of a cyclase essential for all tocopherol biosynthesis.2002 · DOI: 10.1073/pnas.182330899

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0276500`	Involved in the synthesis of both tocopherols and tocotrienols (vitamin E), which presumably protect photosynthetic complexes from oxidative stress.	The role of tocopherol cyclase in salt stress tolerance of rice (Oryza sativa).2011 · DOI: 10.1007/s11427-011-4138-1

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015609 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006979 response to oxidative stress Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009644 response to high light intensity Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009915 phloem sucrose loading Biological Process

GO:0010189 vitamin E biosynthetic process Biological Process

GO:0015994 chlorophyll metabolic process Biological Process

GO:0016122 xanthophyll metabolic process Biological Process

GO:0031347 regulation of defense response Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT4G32770

dosa:Os02g0276500

zma:541877

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.976

Rank 1 · TkA02G309410 · TK1151

Mitochondrion0.038

Rank 2 · TkA02G309410 · TK1151

Cytoplasm0.019

Rank 3 · TkA02G309410 · TK1151

Nucleus0.016

Rank 4 · TkA02G309410 · TK1151

Peroxisome0.013

Rank 5 · TkA02G309410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14249Tocopherol_cycl106-458 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G309410	`PF14249`	Tocopherol_cycl	106	458	4.6e-137	457.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94FY7`	Arabidopsis thaliana	sp\|Q94FY7\|TOCC_ARATH Tocopherol cyclase, chloroplastic	68.100%	Swiss-Prot	High
`Q6K7V6`	Oryza sativa subsp. japonica	sp\|Q6K7V6\|TOCC_ORYSJ Probable tocopherol cyclase, chloroplastic	67.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card