TkA02G309360 | RubberDandelionOmics

Gene overview

TkA02G309360

Reference: TK1151 Chr: Chr02 Coordinates: 78729373-78737676 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2064 bp · TkA02G309360|TK1151|cDNA

GTTGAACCCACGCATCTTCAACTTCAACTCATAAATAGCATTCAAGGAAAGATCAACAATTGATACTTTTCTATGTCTTTCCTTCAAGCATCAGTTATATATAAAGTTGAACCCACGCATCTTCAACTTCAACTCATCAAATATCCTTCTTTTTTTCAACTCACGTATGGCTAACACTCCGATCCTGGTGCTCTTATTTCTAGTTTTGTGGGCTTCAACCACCACCGCCATCCCACCACCACCACCAATTCAGTGCACCG...

CDS

Download CDS FASTA

1743 bp · TkA02G309360|TK1151|CDS

ATGGCTAACACTCCGATCCTGGTGCTCTTATTTCTAGTTTTGTGGGCTTCAACCACCACCGCCATCCCACCACCACCACCAATTCAGTGCACCGTCGGAACCACCGGCTGCACCCTCCACAACTCCTACGGCATATGGGGTGACAGAAAAGACTGTCTTGCCTCCCACGTCATCTACCCAACGACCCAACAACAACTTCTCTCAATCGTAGCCAATGCAGCCAAAAACAAACTTAAACTCAAAGTAGTCTCCAAATTCTC...

Protein

Download Protein FASTA

580 aa · TkA02G309360|TK1151|PROTEIN

MANTPILVLLFLVLWASTTTAIPPPPPIQCTVGTTGCTLHNSYGIWGDRKDCLASHVIYPTTQQQLLSIVANAAKNKLKLKVVSKFSHTIPKFACPAAGNSSVLISTEKYNSGIDIDVAGLTVTADAGVSLRDLINKVENAGLSLVAAPYWEGVSVGGVISTGAHGSSWWGKGGAVHDHVVKIDMVVPAKENEGFAKILHLDSKNQLFNAAKVSLGTLGIISKVTLSLEKWFKRSITFNFTDDGGLEDEFISHAKAHEFG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G309360`
TK1151 ID	TkA02G309360
OH-1004 ID	LXL04_015610
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G309360

Location Chr02:78729373-78737676 (-)

Description Similar to GULLO3: L-gulonolactone oxidase 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g11540`	Catalyzes the oxidation of L-gulono-1,4-lactone to ascorbic acid.	No verified direct reference in this release
`At2g46740`	Catalyzes the oxidation of L-gulono-1,4-lactone to ascorbic acid.	No verified direct reference in this release
`At2g46750`	Catalyzes the oxidation of L-gulono-1,4-lactone to ascorbic acid.	The contribution of Arabidopsis homologs of L-gulono-1,4-lactone oxidase to the biosynthesis of ascorbic acid.2010 · DOI: 10.1271/bbb.100157
`At2g46760`	May be involved in the biosynthesis of ascorbic acid.	No verified direct reference in this release
`At1g32300`	May be involved in the biosynthesis of ascorbic acid.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015610 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0019853 L-ascorbic acid biosynthetic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0003885 D-arabinono-1,4-lactone oxidase activity Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

GO:0050105 L-gulonolactone oxidase activity Molecular Function

GO:0071949 FAD binding Molecular Function

KEGG gene cross-reference

ath:AT1G32300

ath:AT2G46740

ath:AT2G46750

ath:AT2G46760

ath:AT5G11540

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.340

Rank 1 · TkA02G309360 · TK1151

Lysosome / Vacuole0.271

Rank 2 · TkA02G309360 · TK1151

Cell membrane0.160

Rank 3 · TkA02G309360 · TK1151

Endoplasmic reticulum0.110

Rank 4 · TkA02G309360 · TK1151

Cytoplasm0.100

Rank 5 · TkA02G309360 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20381Rv147650-83 aa

PF01565FAD_binding_455-187 aa

PF25638DUF5983_N69-88 aa

PF20381Rv1476111-142 aa

PF25638DUF5983_N128-145 aa

PF04030ALO247-285 aa

PF01565FAD_binding_4276-302 aa

PF17492D_CNTX322-334 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G309360	`PF20381`	Rv1476	50	83	0.12	12.8
TkA02G309360	`PF01565`	FAD_binding_4	55	187	2.2e-17	63.8
TkA02G309360	`PF25638`	DUF5983_N	69	88	0.19	12.1
TkA02G309360	`PF20381`	Rv1476	111	142	0.12	12.8
TkA02G309360	`PF25638`	DUF5983_N	128	145	0.19	12.1
TkA02G309360	`PF04030`	ALO	247	285	4.4e-15	56.8
TkA02G309360	`PF01565`	FAD_binding_4	276	302	2.2e-17	63.8
TkA02G309360	`PF17492`	D_CNTX	322	334	2.9	8.9
TkA02G309360	`PF01565`	FAD_binding_4	425	448	2.2e-17	63.8
TkA02G309360	`PF04030`	ALO	427	524	4.4e-15	56.8
TkA02G309360	`PF22906`	GULLO2-like_3rd	536	574	6.4e-20	71.3
TkA02G309360	`PF17492`	D_CNTX	536	560	2.9	8.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LYD8`	Arabidopsis thaliana	sp\|Q9LYD8\|GGLO3_ARATH L-gulonolactone oxidase 3	66.100%	Swiss-Prot	High
`O81030`	Arabidopsis thaliana	sp\|O81030\|GGLO5_ARATH L-gulonolactone oxidase 5	46.000%	Swiss-Prot	Medium
`Q6NQ66`	Arabidopsis thaliana	sp\|Q6NQ66\|GGLO2_ARATH L-gulonolactone oxidase 2	46.200%	Swiss-Prot	Medium
`O81032`	Arabidopsis thaliana	sp\|O81032\|GGLO6_ARATH Probable L-gulonolactone oxidase 6	46.400%	Swiss-Prot	Medium
`Q9C614`	Arabidopsis thaliana	sp\|Q9C614\|GGLO1_ARATH Probable L-gulonolactone oxidase 1	44.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card