TkA02G300310 | RubberDandelionOmics

Gene overview

TkA02G300310

Reference: TK1151 Chr: Chr02 Coordinates: 76529581-76533954 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2574 bp · TkA02G300310|TK1151|cDNA

TTAATTTGAAATGTGAGGGTTAGAAGTTCCGTGAAAAGGGCGCTTTCGATTTCGAGTCTTTGGGAAACCAAAGAATCGTAGCCAACGCCAACGCCAACGCCAACGCCATTTCCGTACTCTCACCTTTAACATCACTACCCTCCATCTCCCGTCGGAGCTGCAATGAAGCGAGGGTTCGAATCAGTCGAAATATCAGACGACGAATGGTCAAACCACGATTTCGATTCTTCCCGAATTCTCAATAAACCCTCTTCCAGAAT...

CDS

Download CDS FASTA

2256 bp · TkA02G300310|TK1151|CDS

ATGAAGCGAGGGTTCGAATCAGTCGAAATATCAGACGACGAATGGTCAAACCACGATTTCGATTCTTCCCGAATTCTCAATAAACCCTCTTCCAGAATCCCTCCACCACCAATCGAGTCTTTCGCTTTCAGAAGCGGAGGCAAACAAGGAGGAACACCGTCTACTTCGAAACCGTCCTTTGACTACTCCTCGGACTCCTCTGACTGTGTTGAAGTCATCAAAGATGGAGCTCAACATGCACTTGAAAGTTTGGAGGATGA...

Protein

Download Protein FASTA

751 aa · TkA02G300310|TK1151|PROTEIN

MKRGFESVEISDDEWSNHDFDSSRILNKPSSRIPPPPIESFAFRSGGKQGGTPSTSKPSFDYSSDSSDCVEVIKDGAQHALESLEDDDFGEAPSTTIENRGRRFVIDDEDDEVVEDDAIDLGGEEDGDSEDLGFGEDVEGSDDIVGKALHKCSKLSTELRKELYGSSSTDACDRYAEVESSSVRIVTNDDICEACGMEDSGFQPVLKPYQLVGVNFLMLLYRKKVAGAILADEMGLGKTIQAITYLMLLNHLEDDPGPHL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G300310`
TK1151 ID	TkA02G300310
OH-1004 ID	LXL04_015692
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G300310

Location Chr02:76529581-76533954 (-)

Description Similar to ETL1: Protein CHROMATIN REMODELING 19

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g02090`	DNA helicase that possesses intrinsic ATP-dependent nucleosome-remodeling activity and is both required for DNA repair and heterochromatin organization.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015692 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000018 regulation of DNA recombination Biological Process

GO:0000729 DNA double-strand break processing Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006974 DNA damage response Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0031507 heterochromatin formation Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0051304 chromosome separation Biological Process

GO:0071494 cellular response to UV-C Biological Process

GO:0000785 chromatin Cellular Component

GO:0000792 heterochromatin Cellular Component

KEGG gene cross-reference

ath:AT2G02090

dre:563175

hsa:56916

xtr:548414

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.896

Rank 1 · TkA02G300310 · TK1151

Cytoplasm0.184

Rank 2 · TkA02G300310 · TK1151

Mitochondrion0.033

Rank 3 · TkA02G300310 · TK1151

Cell membrane0.021

Rank 4 · TkA02G300310 · TK1151

Endoplasmic reticulum0.014

Rank 5 · TkA02G300310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII206-379 aa

PF00176SNF2-rel_dom209-506 aa

PF00270DEAD229-382 aa

PF13401AAA_22235-379 aa

PF00271Helicase_C254-322 aa

PF18766SWI2_SNF2315-383 aa

PF11625DUF3253346-377 aa

PF00270DEAD445-471 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G300310	`PF04851`	ResIII	206	379	8e-07	29.8
TkA02G300310	`PF00176`	SNF2-rel_dom	209	506	9.7e-67	225.8
TkA02G300310	`PF00270`	DEAD	229	382	1.2e-06	29.1
TkA02G300310	`PF13401`	AAA_22	235	379	0.23	12.5
TkA02G300310	`PF00271`	Helicase_C	254	322	6.6e-24	85.0
TkA02G300310	`PF18766`	SWI2_SNF2	315	383	0.17	12.3
TkA02G300310	`PF11625`	DUF3253	346	377	0.71	10.8
TkA02G300310	`PF00270`	DEAD	445	471	1.2e-06	29.1
TkA02G300310	`PF11625`	DUF3253	454	484	0.71	10.8
TkA02G300310	`PF11496`	HDA2-3	486	509	0.024	14.5
TkA02G300310	`PF11496`	HDA2-3	567	713	0.024	14.5
TkA02G300310	`PF16203`	ERCC3_RAD25_C	576	720	0.0075	16.3
TkA02G300310	`PF00271`	Helicase_C	579	689	6.6e-24	85.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUL5`	Arabidopsis thaliana	sp\|Q9ZUL5\|CHR19_ARATH Protein CHROMATIN REMODELING 19	66.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card