RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G261050
Reference: TK1151 Chr: Chr02 Coordinates: 66588092-66589312 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

771 bp · TkA02G261050|TK1151|cDNA

ATGGGACTTTATGCAGAAATGCATAACAAAGTTGAAGAACATCTTAGATGGTCCCACAGAGCAACAGTTCAGCTCAGAGGACTATATGATGCTATATACGTTAGATGTCTTTCTAGATTCTTCCATTATCTTGATAGATATTTCATCACAAGAAGATCTCTCCCTGCTCTTAAAGAAGTTGGACTCACCTATTTCCGTGATTTGGTATATCAAGAGTTACATGGGAAAGTAAGGGATGCTGTAATAGCTCTGATTGATCA...

CDS

Download CDS FASTA

771 bp · TkA02G261050|TK1151|CDS

ATGGGACTTTATGCAGAAATGCATAACAAAGTTGAAGAACATCTTAGATGGTCCCACAGAGCAACAGTTCAGCTCAGAGGACTATATGATGCTATATACGTTAGATGTCTTTCTAGATTCTTCCATTATCTTGATAGATATTTCATCACAAGAAGATCTCTCCCTGCTCTTAAAGAAGTTGGACTCACCTATTTCCGTGATTTGGTATATCAAGAGTTACATGGGAAAGTAAGGGATGCTGTAATAGCTCTGATTGATCA...

Protein

Download Protein FASTA

256 aa · TkA02G261050|TK1151|PROTEIN

MGLYAEMHNKVEEHLRWSHRATVQLRGLYDAIYVRCLSRFFHYLDRYFITRRSLPALKEVGLTYFRDLVYQELHGKVRDAVIALIDQEREGEQIDRGLLKNILDIFVEIGMGQMEYYENDFEAFVLKDTSSYYSRKASNWILQDSCPDYMLKAEECLKREKDRVSHYLHFSSEPKLLEKVQNELLSIYATQLLEKEHFGCHALLKDDKVDDLSKMFRLFSKIPHGLDPVSTMFKQVCYYYFFLKQNAIICIFYKKN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G261050
TK1151 IDTkA02G261050
OH-1004 IDLXL04_012540
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)98.700
Protein coverage (%)TK1151 92.578 / OH-1004 68.391
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G261050
LocationChr02:66588092-66589312 (-)
DescriptionSimilar to CUL1: Cullin-1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g02570 Involved in ubiquitination and subsequent proteasomal degradation of target proteins.
Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis.2002 · DOI: 10.1091/mbc.e02-02-0077
Arabidopsis CAND1, an unmodified CUL1-interacting protein, is involved in multiple developmental pathways controlled by ubiquitin/proteasome-mediated protein Degradation.2004 · DOI: 10.1105/tpc.021949
At1g43140 Putative cullin-like protein 1. No verified direct reference in this release
At1g02980 Core component of multiple SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complexes. No verified direct reference in this release
At1g59790 Putative cullin-like protein 2. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0369000 Involved in ubiquitination and subsequent proteasomal degradation of target proteins. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_012540 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006511 ubiquitin-dependent protein catabolic process Biological Process
GO:0009733 response to auxin Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009867 jasmonic acid mediated signaling pathway Biological Process
GO:0009873 ethylene-activated signaling pathway Biological Process
GO:0010087 phloem or xylem histogenesis Biological Process
GO:0010265 SCF complex assembly Biological Process
GO:0016567 protein ubiquitination Biological Process
GO:0042752 regulation of circadian rhythm Biological Process
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process
KEGG gene cross-reference
ath:AT1G02980
ath:AT1G43140
ath:AT1G59790
ath:AT4G02570
dosa:Os01g0369000
osa:4325735
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.593
Rank 1 · TkA02G261050 · TK1151
Nucleus0.305
Rank 2 · TkA02G261050 · TK1151
Golgi apparatus0.139
Rank 3 · TkA02G261050 · TK1151
Endoplasmic reticulum0.116
Rank 4 · TkA02G261050 · TK1151
Cell membrane0.103
Rank 5 · TkA02G261050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17053GEP519-39 aa
PF00888Cullin33-235 aa
PF28135ELG1_C35-47 aa
PF17514DUF544299-137 aa
PF17514DUF5442153-169 aa
PF28135ELG1_C158-169 aa
PF17053GEP5168-254 aa
PF03507CagA205-215 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G261050PF17053GEP519390.03914.7
TkA02G261050PF00888Cullin332353.2e-51175.8
TkA02G261050PF28135ELG1_C35470.07413.3
TkA02G261050PF17514DUF5442991370.06914.1
TkA02G261050PF17514DUF54421531690.06914.1
TkA02G261050PF28135ELG1_C1581690.07413.3
TkA02G261050PF17053GEP51682540.03914.7
TkA02G261050PF03507CagA2052150.1912.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94AH6Arabidopsis thalianasp|Q94AH6|CUL1_ARATH Cullin-175.500%Swiss-ProtHigh
P0CH31Arabidopsis thalianasp|P0CH31|CLL1_ARATH Putative cullin-like protein 158.900%Swiss-ProtHigh
Q9SRZ0Arabidopsis thalianasp|Q9SRZ0|CUL2_ARATH Cullin-258.000%Swiss-ProtHigh
Q9XIE9Arabidopsis thalianasp|Q9XIE9|CLL2_ARATH Putative cullin-like protein 258.300%Swiss-ProtHigh
Q5ZC88Oryza sativa subsp. japonicasp|Q5ZC88|CUL1_ORYSJ Cullin-169.100%Swiss-ProtHigh

JBrowse

View in Genome Browser