TkA02G221330 | RubberDandelionOmics

Gene overview

TkA02G221330

Reference: TK1151 Chr: Chr02 Coordinates: 57353585-57354010 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

354 bp · TkA02G221330|TK1151|cDNA

ATGTCCGTTTCTCCCCAAAACTATTCTACCTCAGAATCCACATCATTGAAGCTTAATATTCCCATCATCTGTCATACAATTTATCGTAGTCAGTCTCATCTCTCGAGTTTTAATCATAGTCCAGTAGTCTTCCATGTGGACCGCAGTCTTCTCCCTGAGTTTTACGTCCAGATAGTCCTCGAAAGCCAGATACGAACCACCAGAAGGTTTCTTATAATCAGCGCCGAGGATCAAATCGGGCCATGGCAAAACAAATGGGT...

CDS

Download CDS FASTA

354 bp · TkA02G221330|TK1151|CDS

ATGTCCGTTTCTCCCCAAAACTATTCTACCTCAGAATCCACATCATTGAAGCTTAATATTCCCATCATCTGTCATACAATTTATCGTAGTCAGTCTCATCTCTCGAGTTTTAATCATAGTCCAGTAGTCTTCCATGTGGACCGCAGTCTTCTCCCTGAGTTTTACGTCCAGATAGTCCTCGAAAGCCAGATACGAACCACCAGAAGGTTTCTTATAATCAGCGCCGAGGATCAAATCGGGCCATGGCAAAACAAATGGGT...

Protein

Download Protein FASTA

117 aa · TkA02G221330|TK1151|PROTEIN

MSVSPQNYSTSESTSLKLNIPIICHTIYRSQSHLSSFNHSPVVFHVDRSLLPEFYVQIVLESQIRTTRRFLIISAEDQIGPWQNKWVRTRTLLNALKPRWNEQCTWDVFMRGQILMI

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G221330`
TK1151 ID	TkA02G221330
OH-1004 ID	LXL04_024364
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	57.600
Protein coverage (%)	TK1151 64.103 / OH-1004 58.580 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G221330

Location Chr02:57353585-57354010 (-)

Description Similar to FTIP7: FT-interacting protein 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22610`	Regulates flowering time under long days.	Characterization of Multiple C2 Domain and Transmembrane Region Proteins in Arabidopsis.2018 · DOI: 10.1104/pp.17.01144
`At3g61720`	May function as a signaling molecule by regulating the trafficking of other regulators.	No verified direct reference in this release
`At5g48060`	May function as a signaling molecule by regulating the trafficking of other regulators.	No verified direct reference in this release
`At5g03435`	May function as a signaling molecule by regulating the trafficking of other regulators.	No verified direct reference in this release
`At4g00700`	May function as a signaling molecule by regulating the trafficking of other regulators.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024364 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009663 plasmodesma organization Biological Process

GO:0009901 anther dehiscence Biological Process

GO:0009911 positive regulation of flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010930 negative regulation of auxin mediated signaling pathway Biological Process

GO:0048574 long-day photoperiodism, flowering Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT1G22610

ath:AT5G12970

dosa:Os05g0370600

osa:4338582

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.437

Rank 1 · TkA02G221330 · TK1151

Nucleus0.386

Rank 2 · TkA02G221330 · TK1151

Mitochondrion0.144

Rank 3 · TkA02G221330 · TK1151

Cell membrane0.076

Rank 4 · TkA02G221330 · TK1151

Endoplasmic reticulum0.059

Rank 5 · TkA02G221330 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168C282-115 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G221330	`PF00168`	C2	82	115	0.00027	21.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SKA3`	Arabidopsis thaliana	sp\|Q9SKA3\|MCTP6_ARATH Multiple C2 domain and transmembrane region protein 6	43.900%	Swiss-Prot	Low
`Q9M366`	Arabidopsis thaliana	sp\|Q9M366\|MCT12_ARATH Multiple C2 domain and transmembrane region protein 12	43.600%	Swiss-Prot	Low
`Q9FI32`	Arabidopsis thaliana	sp\|Q9FI32\|MCTP2_ARATH Multiple C2 domain and transmembrane region protein 2	58.100%	Swiss-Prot	Low
`Q9LZE5`	Arabidopsis thaliana	sp\|Q9LZE5\|MCT13_ARATH Multiple C2 domain and transmembrane region protein 13	41.000%	Swiss-Prot	Low
`Q8RXU9`	Arabidopsis thaliana	sp\|Q8RXU9\|MCTP9_ARATH Multiple C2 domain and transmembrane region protein 9	43.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card