TkA02G185240 | RubberDandelionOmics

Gene overview

TkA02G185240

Reference: TK1151 Chr: Chr02 Coordinates: 47635360-47638109 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2582 bp · TkA02G185240|TK1151|cDNA

TAGGTAGATTTTATTGATTATGGCTATAAAGACAAAAATTTCTCACAAAGTGACTCTACAAATGACACATAAGTAGTTTTTAGAAAAATCCCATGTAGATATCTAAAAGTCTTTTACTATCACCTATAAGCCAATAACCCATAAACATTACTGCCATGTTGTAATCGCGTGGCATCCTCCATCCTGGAGTAGTGCTCCATGCATGGCTATGGCTGCATAACACCACCACCATCCGTTTCCACCTTCAGTTTTCCCAAATC...

CDS

Download CDS FASTA

1875 bp · TkA02G185240|TK1151|CDS

ATGTTCCGATCATCATCCACCCTCAAACCAGGCCCAACTCAGGAAAACCATCCCAAGCCCCGGCCAGCGCGCGACCCAGATATGGAAGGTTCTTCCCTCACCGACGACCCTCAGATACGACTCGCGCTCTACATAGCGATGGCCCACGCCGGCGTCGCCTTCGCCTGTTTGCTTCTTTACGGTGTAAGTAAAATCCTCGAATATTATCTCCGGGCATTGCTTTGGGCCGTTATTTGTTCGATCCCTCTTCGCGGAATCCA...

Protein

Download Protein FASTA

624 aa · TkA02G185240|TK1151|PROTEIN

MFRSSSTLKPGPTQENHPKPRPARDPDMEGSSLTDDPQIRLALYIAMAHAGVAFACLLLYGVSKILEYYLRALLWAVICSIPLRGIQHTLVSFWSKPLESGLTDTILAVPTSMFRAFIGTVVEITDLLFKIIGRPRRSFSPPRRTGSGFSIVFRRLVSLWVFVMAYEQIGGIGATALLVLGFMFTSGNVESTMSAVSSLKSYSFKRTPRTSFLTRGILKKLETIVAIGLILGMIVGSLVAAIFFSYKIGVEGRDAVYSIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G185240`
TK1151 ID	TkA02G185240
OH-1004 ID	LXL04_037270
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	62.600
Protein coverage (%)	TK1151 99.679 / OH-1004 96.055 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G185240`
Location	Chr02:47635360-47638109 (+)
Description	Similar to TMEM245: Transmembrane protein 245
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_037270` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016020 membrane Cellular Component
KEGG gene cross-reference	hsa:23731 mmu:242474 rno:298020 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.432

Rank 1 · TkA02G185240 · TK1151

Golgi apparatus0.247

Rank 2 · TkA02G185240 · TK1151

Cytoplasm0.172

Rank 3 · TkA02G185240 · TK1151

Cell membrane0.135

Rank 4 · TkA02G185240 · TK1151

Nucleus0.116

Rank 5 · TkA02G185240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19638DUF614157-67 aa

PF01594AI-2E_transport62-88 aa

PF01594AI-2E_transport158-188 aa

PF01594AI-2E_transport220-322 aa

PF24012DUF7326295-326 aa

PF24012DUF7326348-382 aa

PF01594AI-2E_transport383-610 aa

PF19638DUF6141502-566 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G185240	`PF19638`	DUF6141	57	67	1.7	9.2
TkA02G185240	`PF01594`	AI-2E_transport	62	88	1e-06	29.1
TkA02G185240	`PF01594`	AI-2E_transport	158	188	1e-06	29.1
TkA02G185240	`PF01594`	AI-2E_transport	220	322	1e-06	29.1
TkA02G185240	`PF24012`	DUF7326	295	326	0.39	11.8
TkA02G185240	`PF24012`	DUF7326	348	382	0.39	11.8
TkA02G185240	`PF01594`	AI-2E_transport	383	610	1e-06	29.1
TkA02G185240	`PF19638`	DUF6141	502	566	1.7	9.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card