TkA02G184720 | RubberDandelionOmics

Gene overview

TkA02G184720

Reference: TK1151 Chr: Chr02 Coordinates: 47522077-47525439 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2493 bp · TkA02G184720|TK1151|cDNA

CCGGTGACTGCTTTATGGTACACGGGTACAACCGACAAGGCATTTGGTACCACCCTGTATCATTCTCCAATTGATTCAACCTGACTTGGCTCCCTCACTGATTTGTTAATTCGTGTTTTCGTTTTTCCACTCTCGATTTCTCTCTCCGGCTTTTATCGAACTTTCAAAACCCATTTTTTCGTCTGCTATCAAACCCTGTGATTCTCGCTGTATGGTCGCCAAAGACCGTCAAAGCAAAACAGAGTCTCCAAAAGTGGAGG...

CDS

Download CDS FASTA

1917 bp · TkA02G184720|TK1151|CDS

ATGGTCGCCAAAGACCGTCAAAGCAAAACAGAGTCTCCAAAAGTGGAGGTCGGAGAGATTGACACCAGGGCACCATTCCAATCGGTCAAAGATGCAGTCAATCTTTTTGGAGAAGGTGCTTTTTCTGGCGAAAAACTCACCATCAAGAAAATTAAACCTCATTCCACTGAAAGGGTGTTGGTGAAGGAGACAAAGCTCCATTTAGCCCAGAAAGAGCTTGATAAATTAAAAGAACAGTTAAAGATTGCCGAATCAACAAA...

Protein

Download Protein FASTA

638 aa · TkA02G184720|TK1151|PROTEIN

MVAKDRQSKTESPKVEVGEIDTRAPFQSVKDAVNLFGEGAFSGEKLTIKKIKPHSTERVLVKETKLHLAQKELDKLKEQLKIAESTKTGALTELEKAKRTVDDLKNKLHIINEAKESAIKATEMAKDEAKKLNVGETNCNGDLETSKEQYAAVFTQLDAAKQELRRIRHDHETAMEEKAQVIREEQEAEVMSKVNIDKAGEISKEIMSVQEAIEHVKLAAMEVKQEQDKIVSEKNVQKLAHRSALEESAKKLVALREQID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G184720`
TK1151 ID	TkA02G184720
OH-1004 ID	LXL04_016143
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 94.659 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G184720

Location Chr02:47522077-47525439 (+)

Description Similar to At5g55860: WEB family protein At5g55860

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55860`	WEB family protein At5g55860.	No verified direct reference in this release
`At1g12150`	WEB family protein At1g12150.	No verified direct reference in this release
`At4g17210`	Putative WEB family protein At4g17210.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016143 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009903 chloroplast avoidance movement Biological Process

GO:0009904 chloroplast accumulation movement Biological Process

GO:0071260 cellular response to mechanical stimulus Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

KEGG gene cross-reference

ath:AT1G12150

ath:AT2G26570

ath:AT4G17210

ath:AT4G33390

ath:AT5G55860

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.554

Rank 1 · TkA02G184720 · TK1151

Cell membrane0.323

Rank 2 · TkA02G184720 · TK1151

Nucleus0.245

Rank 3 · TkA02G184720 · TK1151

Plastid0.056

Rank 4 · TkA02G184720 · TK1151

Endoplasmic reticulum0.051

Rank 5 · TkA02G184720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05701WEMBL19-561 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G184720	`PF05701`	WEMBL	19	561	9.1e-47	160.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVQ4`	Arabidopsis thaliana	sp\|Q9LVQ4\|Y5586_ARATH WEB family protein At5g55860	39.500%	Swiss-Prot	Medium
`Q9FWW5`	Arabidopsis thaliana	sp\|Q9FWW5\|Y1215_ARATH WEB family protein At1g12150	38.500%	Swiss-Prot	Low
`O23564`	Arabidopsis thaliana	sp\|O23564\|Y4721_ARATH Putative WEB family protein At4g17210	28.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card