TkA02G174860 | RubberDandelionOmics

Gene overview

TkA02G174860

Reference: TK1151 Chr: Chr02 Coordinates: 45038738-45040501 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1000 bp · TkA02G174860|TK1151|cDNA

AAATAACTGGGCTTCGAAGTTCCAGTTAAATTCTATTAGCCTAGGGTTTCTGAGCAATACCGATAGAAGTAAATCACCCTTTTAAGCCACTCCCCCTCAAAACCCTACCTCTCTCCTCATCCAAGAGCTCGAGGACAGCGGCGCACGGAGCATCTTCGTGGTCTGCAAACATGGGTATCTCTCGTGATTCTATGCACAAAAGACGTGCCACTGGGGGCAAGAAGAAGGCGTGGAGAAAGAAGCGAAAGTACGAGCTCGGA...

CDS

Download CDS FASTA

660 bp · TkA02G174860|TK1151|CDS

ATGGGTATCTCTCGTGATTCTATGCACAAAAGACGTGCCACTGGGGGCAAGAAGAAGGCGTGGAGAAAGAAGCGAAAGTACGAGCTCGGAAGACAGCCAGCGAACACCAAAATCTCGAGCAACAAGACTGTTCGAAGAGTTAGGGTTCGTGGTGGCAACGTCAAGTGGCGCGCACTAAGGTTAGACACAGGCAACTACTCATGGGGAAGCGAGGCCGTTACCAGAAAGACGCGTATCCTGGATGTGGTTTACAATGCATC...

Protein

Download Protein FASTA

219 aa · TkA02G174860|TK1151|PROTEIN

MGISRDSMHKRRATGGKKKAWRKKRKYELGRQPANTKISSNKTVRRVRVRGGNVKWRALRLDTGNYSWGSEAVTRKTRILDVVYNASNNELVRTQTLVKSAIVQVDAAPFKQWYLQHYGVDIGRKKKAPVSATKKEGEEVEGATEETKKSNHVVRKLEKRQEERKLDAHVEEQFSSGRLLAAISSRPGQCGRADGYILEGKELEFYMKKLQKKKGKGAA

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G174860`
TK1151 ID	TkA02G174860
OH-1004 ID	LXL04_016199
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G174860

Location Chr02:45038738-45040501 (-)

Description Similar to RPS8: 40S ribosomal protein S8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g59240`	Small ribosomal subunit protein eS8y.	No verified direct reference in this release
`At5g20290`	Small ribosomal subunit protein eS8z.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0489400`	Small ribosomal subunit protein eS8.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016199 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process

GO:0006412 translation Biological Process

GO:0042255 ribosome assembly Biological Process

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005840 ribosome Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:0043253 chloroplast ribosome Cellular Component

KEGG gene cross-reference

ath:AT5G20290

ath:AT5G59240

dosa:Os02g0489400

zma:103654826

zma:103654828

zma:542341

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.859

Rank 1 · TkA02G174860 · TK1151

Nucleus0.242

Rank 2 · TkA02G174860 · TK1151

Endoplasmic reticulum0.101

Rank 3 · TkA02G174860 · TK1151

Mitochondrion0.017

Rank 4 · TkA02G174860 · TK1151

Cell membrane0.013

Rank 5 · TkA02G174860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01201Ribosomal_S8e5-198 aa

PF13476AAA_2313-174 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G174860	`PF01201`	Ribosomal_S8e	5	198	4.9e-53	179.7
TkA02G174860	`PF13476`	AAA_23	13	174	0.051	14.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIF3`	Arabidopsis thaliana	sp\|Q9FIF3\|RS82_ARATH Small ribosomal subunit protein eS8y	85.800%	Swiss-Prot	High
`Q93VG5`	Arabidopsis thaliana	sp\|Q93VG5\|RS81_ARATH Small ribosomal subunit protein eS8z	78.800%	Swiss-Prot	High
`P49199`	Oryza sativa subsp. japonica	sp\|P49199\|RS8_ORYSJ Small ribosomal subunit protein eS8	89.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card