TkA02G174680 | RubberDandelionOmics

Gene overview

TkA02G174680

Reference: TK1151 Chr: Chr02 Coordinates: 44991913-44994176 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

666 bp · TkA02G174680|TK1151|cDNA

ATGCAACTCGGAGCCTACTTTGCTTTCCAGCATCTATTCAATGATGTTCGCGAATCAACGGAAGATCATGGTCATGGCAGACTGATTTCTCAACGTCAGGCTTGTGTAGACGTCTTCTGGTGGTCACCGCATTTTGTATTCCTTTGTAATCCGCCACAAATTCAGGAAGTGGATGCTCTTGCGGAGATAAAGTCATACTTAATCTTTTGTTGTAAGACTTATAAACAGACTAATTTAGGTTTTTTGGAATCTGGAAAAGA...

CDS

Download CDS FASTA

666 bp · TkA02G174680|TK1151|CDS

ATGCAACTCGGAGCCTACTTTGCTTTCCAGCATCTATTCAATGATGTTCGCGAATCAACGGAAGATCATGGTCATGGCAGACTGATTTCTCAACGTCAGGCTTGTGTAGACGTCTTCTGGTGGTCACCGCATTTTGTATTCCTTTGTAATCCGCCACAAATTCAGGAAGTGGATGCTCTTGCGGAGATAAAGTCATACTTAATCTTTTGTTGTAAGACTTATAAACAGACTAATTTAGGTTTTTTGGAATCTGGAAAAGA...

Protein

Download Protein FASTA

221 aa · TkA02G174680|TK1151|PROTEIN

MQLGAYFAFQHLFNDVRESTEDHGHGRLISQRQACVDVFWWSPHFVFLCNPPQIQEVDALAEIKSYLIFCCKTYKQTNLGFLESGKDTFCDDGLTVSTTILVGNHLYVANVGDSRTVISKSENAIPLFVAVVVAESEIQVNGVMADGTIYFQRAKGRSIETARKDNCWLVKNLVTELRKEAESRIGEAEIGIGEAGIGIGEAGIRIGETYERLNLCCFFLH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G174680`
TK1151 ID	TkA02G174680
OH-1004 ID	LXL04_012507
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.100
Protein coverage (%)	TK1151 59.276 / OH-1004 96.324 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G174680

Location Chr02:44991913-44994176 (+)

Description Similar to At5g53140: Probable protein phosphatase 2C 76

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g53140`	Probable protein phosphatase 2C 76.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0587100`	Probable protein phosphatase 2C 52.	No verified direct reference in this release
`Os02g0255100`	Probable protein phosphatase that may play a role as a mitochondrial signal transduction mediator in pollen germination.	DCW11, down-regulated gene 11 in CW-type cytoplasmic male sterile rice, encoding mitochondrial protein phosphatase 2c is related to cytoplasmic male sterility.2008 · DOI: 10.1093/pcp/pcn036
`Os01g0618200`	Probable protein phosphatase 2C 7.	No verified direct reference in this release
`UniProt: Q0DBU3`	Probable protein phosphatase 2C 56.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012507 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0009846 pollen germination Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G53140

dosa:Os02g0255100

dosa:Os05g0587100

dosa:Os06g0526800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.487

Rank 1 · TkA02G174680 · TK1151

Nucleus0.339

Rank 2 · TkA02G174680 · TK1151

Mitochondrion0.138

Rank 3 · TkA02G174680 · TK1151

Cell membrane0.081

Rank 4 · TkA02G174680 · TK1151

Endoplasmic reticulum0.065

Rank 5 · TkA02G174680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C91-126 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G174680	`PF00481`	PP2C	91	126	7.5e-07	29.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AT1`	Arabidopsis thaliana	sp\|Q94AT1\|P2C76_ARATH Probable protein phosphatase 2C 76	67.900%	Swiss-Prot	Low
`Q6L5C4`	Oryza sativa subsp. japonica	sp\|Q6L5C4\|P2C52_ORYSJ Probable protein phosphatase 2C 52	64.300%	Swiss-Prot	Low
`Q6EN45`	Oryza sativa subsp. japonica	sp\|Q6EN45\|P2C13_ORYSJ Probable protein phosphatase 2C member 13, mitochondrial	58.900%	Swiss-Prot	Low
`Q0JL75`	Oryza sativa subsp. japonica	sp\|Q0JL75\|P2C07_ORYSJ Probable protein phosphatase 2C 7	55.400%	Swiss-Prot	Low
`Q0DBU3`	Oryza sativa subsp. japonica	sp\|Q0DBU3\|P2C56_ORYSJ Probable protein phosphatase 2C 56	35.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card