TkA02G134770 | RubberDandelionOmics

Gene overview

TkA02G134770

Reference: TK1151 Chr: Chr02 Coordinates: 34812556-34813920 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1032 bp · TkA02G134770|TK1151|cDNA

ATGGAGTCTACCACCACCACCACCCAATCCTCAGCGCCATGGCCGGAGGTCCTCGGGAGCAAAAACTGGGAAGGTCTTCTCGACCCATTCGACATCACTCTCCGGAATCTCATCCTCCTGTGTGGCGACCTCTGTCAAGCCACCTACGACGCCTTCAACAACGATAAGAATTCAAAGTACGCCGGCAGCAGTCGGTACGGTAAGAAATCCTTCTTCCAAAAAGCCATGCTCCAACCATCTCCTTCCGATTACCAAATCGC...

CDS

Download CDS FASTA

1032 bp · TkA02G134770|TK1151|CDS

ATGGAGTCTACCACCACCACCACCCAATCCTCAGCGCCATGGCCGGAGGTCCTCGGGAGCAAAAACTGGGAAGGTCTTCTCGACCCATTCGACATCACTCTCCGGAATCTCATCCTCCTGTGTGGCGACCTCTGTCAAGCCACCTACGACGCCTTCAACAACGATAAGAATTCAAAGTACGCCGGCAGCAGTCGGTACGGTAAGAAATCCTTCTTCCAAAAAGCCATGCTCCAACCATCTCCTTCCGATTACCAAATCGC...

Protein

Download Protein FASTA

343 aa · TkA02G134770|TK1151|PROTEIN

MESTTTTTQSSAPWPEVLGSKNWEGLLDPFDITLRNLILLCGDLCQATYDAFNNDKNSKYAGSSRYGKKSFFQKAMLQPSPSDYQIATFLYATAKVSVPEAFFVRSLSRESWDRESNWIGYIATTTDEVSKSLGRREIYIVWRGTSRDFEWLNVFDSGDTSSSDSDNDENGGTPKVMQGWLTIYTSDDPNSSFTKQSARTQVLATINQLVETYKNEETSVIITGHSLGASLSILSAFDLVVAGWNGEDDEFELKVKRSLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G134770`
TK1151 ID	TkA02G134770
OH-1004 ID	LXL04_016487
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G134770

Location Chr02:34812556-34813920 (-)

Description Similar to At2g42690: Phospholipase A1-IIdelta

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g42690`	Acylhydrolase that catalyzes the hydrolysis of phosphatidylcholine (PC) at the sn-1 position.	No verified direct reference in this release
`At2g31100`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0710700`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release
`UniProt: B8A8C9`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release
`Os05g0574000`	Acylhydrolase that catalyzes the hydrolysis of phospholipids at the sn-1 position.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016487 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009650 UV protection Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0071493 cellular response to UV-B Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0008970 glycerophospholipid phospholipase A1 activity Molecular Function

KEGG gene cross-reference

ath:AT2G42690

dosa:Os01g0710700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.543

Rank 1 · TkA02G134770 · TK1151

Nucleus0.236

Rank 2 · TkA02G134770 · TK1151

Plastid0.113

Rank 3 · TkA02G134770 · TK1151

Lysosome / Vacuole0.107

Rank 4 · TkA02G134770 · TK1151

Cell membrane0.098

Rank 5 · TkA02G134770 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12697Abhydrolase_675-131 aa

PF11187Mbeg1-like132-146 aa

PF01764Lipase_3139-245 aa

PF12697Abhydrolase_6186-243 aa

PF11187Mbeg1-like187-236 aa

PF00945Rhabdo_ncap194-244 aa

PF07819PGAP1202-232 aa

PF10230LIDHydrolase202-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G134770	`PF12697`	Abhydrolase_6	75	131	0.11	13.9
TkA02G134770	`PF11187`	Mbeg1-like	132	146	0.19	11.7
TkA02G134770	`PF01764`	Lipase_3	139	245	8.2e-18	65.4
TkA02G134770	`PF12697`	Abhydrolase_6	186	243	0.11	13.9
TkA02G134770	`PF11187`	Mbeg1-like	187	236	0.19	11.7
TkA02G134770	`PF00945`	Rhabdo_ncap	194	244	0.094	12.3
TkA02G134770	`PF07819`	PGAP1	202	232	0.078	13.4
TkA02G134770	`PF10230`	LIDHydrolase	202	230	0.36	11.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SJI7`	Arabidopsis thaliana	sp\|Q9SJI7\|PLA20_ARATH Phospholipase A1-IIdelta	46.000%	Swiss-Prot	Medium
`O82274`	Arabidopsis thaliana	sp\|O82274\|PLA19_ARATH Phospholipase A1-IIbeta	46.400%	Swiss-Prot	Medium
`Q5NAI4`	Oryza sativa subsp. japonica	sp\|Q5NAI4\|PLA5_ORYSJ Phospholipase A1-II 5	40.100%	Swiss-Prot	Medium
`B8A8C9`	Oryza sativa subsp. indica	sp\|B8A8C9\|PLA5_ORYSI Phospholipase A1-II 5	40.100%	Swiss-Prot	Medium
`Q6F358`	Oryza sativa subsp. japonica	sp\|Q6F358\|PLA6_ORYSJ Phospholipase A1-II 6	46.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card