TkA02G122100 | RubberDandelionOmics

Gene overview

TkA02G122100

Reference: TK1151 Chr: Chr02 Coordinates: 31716233-31722584 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1780 bp · TkA02G122100|TK1151|cDNA

CAATCGTTTTGAAATTTATTGATGTTGAAGATTACCCACTACACGTCAGTGTATATCTGCATCATCTCTCTCAACGTGACACATTTCGCTCGTTTATAATAGACGGAGTCTTCTGATTTCTCATTTCTTATGATTCGTGCTCGTGATGGCTCCCAAATCTTCCGACTTCCCTGCTGCAGATTCCGAGTATCAGTCTGGCTTTGGAAACCACTTCTCCTCGGAGGCGATAGCCGGAGCGCTTCCTCAGGGTCAAAACAGTC...

CDS

Download CDS FASTA

1371 bp · TkA02G122100|TK1151|CDS

ATGGCTCCCAAATCTTCCGACTTCCCTGCTGCAGATTCCGAGTATCAGTCTGGCTTTGGAAACCACTTCTCCTCGGAGGCGATAGCCGGAGCGCTTCCTCAGGGTCAAAACAGTCCACTTGTTTGTCCTCTTGGTCTCTACGCCGAACAGATCTCCGGCACCTCCTTCACCGCGCCTCGCAAGCTCAATCAGAGAAGTTGGCTGTATCGAATCAAACCTTCAGTAACACATGAACCGTTTAAATCAAGAGTCCCCAAACA...

Protein

Download Protein FASTA

456 aa · TkA02G122100|TK1151|PROTEIN

MAPKSSDFPAADSEYQSGFGNHFSSEAIAGALPQGQNSPLVCPLGLYAEQISGTSFTAPRKLNQRSWLYRIKPSVTHEPFKSRVPKHEKLVSEFSQVNSAINPTQIRWKPVDIPDVPTDFVDGLYSVCGAGSSFLRHGFAIHMYTANKSMENSAFCNADGDFLIVPQSGRLWVTTECGKLQVSPGEIVILPQGFRFAIDLPDGPSRGYVAEVFGTHFQLPDLGPIGANGLASPKDFLVPKASFEQESRPGYTIIQKFGGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G122100`
TK1151 ID	TkA02G122100
OH-1004 ID	LXL04_016579
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G122100

Location Chr02:31716233-31722584 (-)

Description Similar to HGO: Homogentisate 1,2-dioxygenase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54080`	Homogentisate 1,2-dioxygenase.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0103300`	Homogentisate 1,2-dioxygenase.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016579 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006520 amino acid metabolic process Biological Process

GO:0006559 L-phenylalanine catabolic process Biological Process

GO:0006572 L-tyrosine catabolic process Biological Process

GO:1902000 homogentisate catabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0004411 homogentisate 1,2-dioxygenase activity Molecular Function

GO:0042802 identical protein binding Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT5G54080

ddi:DDB_G0283765

dosa:Os06g0103300

hsa:3081

mmu:15233

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.689

Rank 1 · TkA02G122100 · TK1151

Nucleus0.287

Rank 2 · TkA02G122100 · TK1151

Cell membrane0.086

Rank 3 · TkA02G122100 · TK1151

Peroxisome0.083

Rank 4 · TkA02G122100 · TK1151

Endoplasmic reticulum0.075

Rank 5 · TkA02G122100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20510HgmA_N14-287 aa

PF12852Cupin_6163-206 aa

PF04209HgmA_C288-442 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G122100	`PF20510`	HgmA_N	14	287	1.4e-131	438.5
TkA02G122100	`PF12852`	Cupin_6	163	206	0.069	13.6
TkA02G122100	`PF04209`	HgmA_C	288	442	7.1e-77	257.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZRA2`	Arabidopsis thaliana	sp\|Q9ZRA2\|HGD_ARATH Homogentisate 1,2-dioxygenase	81.600%	Swiss-Prot	High
`Q5VRH4`	Oryza sativa subsp. japonica	sp\|Q5VRH4\|HGD_ORYSJ Homogentisate 1,2-dioxygenase	77.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card