RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA02G112470
Reference: TK1151 Chr: Chr02 Coordinates: 29466368-29470792 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2543 bp · TkA02G112470|TK1151|cDNA

CGAAGAGTGGATAAAACAACTTCCGACCGACCCTCTCTTTCATCTATTTAATCAAACACCCCCTACACATATCCATTTCTCTCCTCTCTCTCTCTCTCTCTCTCAAACGTCAGCCACCACCACCACCACCGCAGATCTTCAAATTGAAAAGCATCTCCCCTATTTCCTCGGCCACGATTCAGCATTTTTCAGCTACTGATTGCAAAATTCAGTTGTATAAAATTTGCTTGTGTCGTTGATAGTGGGTGCCGAGCCTTTTC...

CDS

Download CDS FASTA

1746 bp · TkA02G112470|TK1151|CDS

ATGCAACAAGATCCGCGCAGAAAGAATCCAAAAGAGGTTGAATTCTTCACGGAGTACGGTGAATCAAATCGATACAAAATCTTGGAGATCATAGGGAAGGGAAGTTACGGAGTCGTTTGTTCCGCTATTGACACACACACCGGGGAAAAAGTTGCAATCAAGAAAATAACCGACATCTTTGAACATGCCTCCGACGCTATTCGTATCTTGCGTGAAATCAAATTACTCAGGCTTTTAAGACATCCTGATATCGTTGAAAT...

Protein

Download Protein FASTA

581 aa · TkA02G112470|TK1151|PROTEIN

MQQDPRRKNPKEVEFFTEYGESNRYKILEIIGKGSYGVVCSAIDTHTGEKVAIKKITDIFEHASDAIRILREIKLLRLLRHPDIVEIKRIMLPPSRRAFKDIYVVFELMESDLHQVIKANDDLTHEHHRFFLYQMLRALKYMHTANVYHRDLKPKNILANANCKLKICDFGLARVAFNDAPTAVLWTDYVATRWYRAPELCGSFSSKYTPAIDIWSIGCIFAEVLTGKPLFPGKSVVHQLELITDLLGTPSADTISGVRN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA02G112470
TK1151 IDTkA02G112470
OH-1004 IDLXL04_037820
Relationship / confidenceNon Reciprocal Best Hit / Complex relationship
Protein identity (%)70.100
Protein coverage (%)TK1151 97.074 / OH-1004 96.072
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA02G112470
LocationChr02:29466368-29470792 (+)
DescriptionSimilar to MPK18: Mitogen-activated protein kinase 18
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g14720 Mitogen-activated protein kinase 19. No verified direct reference in this release
At1g53510 Mitogen-activated protein kinase (MAPK) that is specifically regulated by PHS1 and MAPKKK20 and mediates signaling that regulates cortical microtubule functions, maybe through regulation of microtubule dynamic instability.
Arabidopsis mitogen-activated protein kinase MPK18 mediates cortical microtubule functions in plant cells.2009 · DOI: 10.1111/j.1365-313x.2009.03895.x
The Arabidopsis Mitogen-Activated Protein Kinase Kinase Kinase 20 (MKKK20) Acts Upstream of MKK3 and MPK18 in Two Separate Signaling Pathways Involved in Root Microtubule Functions.2017 · DOI: 10.3389/fpls.2017.01352
At2g42880 Mitogen-activated protein kinase 20. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0629900 Mitogen-activated protein kinase 10. No verified direct reference in this release
Os01g0665200 Mitogen-activated protein kinase 8. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_037820 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007165 signal transduction Biological Process
GO:0035556 intracellular signal transduction Biological Process
GO:0043622 cortical microtubule organization Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005739 mitochondrion Cellular Component
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0004707 MAP kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference
ath:AT1G53510
ath:AT2G42880
ath:AT3G14720
dosa:Os01g0629900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.702
Rank 1 · TkA02G112470 · TK1151
Nucleus0.293
Rank 2 · TkA02G112470 · TK1151
Cell membrane0.145
Rank 3 · TkA02G112470 · TK1151
Golgi apparatus0.037
Rank 4 · TkA02G112470 · TK1151
Mitochondrion0.033
Rank 5 · TkA02G112470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13095FTA23-42 aa
PF14531Kinase-like24-76 aa
PF00069Pkinase25-316 aa
PF07714PK_Tyr_Ser-Thr27-241 aa
PF03109ABC134-55 aa
PF06293Kdo59-163 aa
PF01636APH60-145 aa
PF14531Kinase-like107-219 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA02G112470PF13095FTA23420.008616.5
TkA02G112470PF14531Kinase-like24760.0003220.8
TkA02G112470PF00069Pkinase253161.1e-65222.4
TkA02G112470PF07714PK_Tyr_Ser-Thr272412.3e-31109.8
TkA02G112470PF03109ABC134550.1112.3
TkA02G112470PF06293Kdo591637.8e-0626.2
TkA02G112470PF01636APH601450.4610.9
TkA02G112470PF14531Kinase-like1072190.0003220.8
TkA02G112470PF01636APH1071760.4610.9
TkA02G112470PF13095FTA21311730.008616.5
TkA02G112470PF12330Haspin_kinase1321880.001118.8
TkA02G112470PF03109ABC11391740.1112.3
TkA02G112470PF01636APH2933370.4610.9
TkA02G112470PF06293Kdo3313527.8e-0626.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LUC3Arabidopsis thalianasp|Q9LUC3|MPK19_ARATH Mitogen-activated protein kinase 1981.500%Swiss-ProtHigh
Q9C5C0Arabidopsis thalianasp|Q9C5C0|MPK18_ARATH Mitogen-activated protein kinase 1880.800%Swiss-ProtHigh
Q9SJG9Arabidopsis thalianasp|Q9SJG9|MPK20_ARATH Mitogen-activated protein kinase 2070.000%Swiss-ProtHigh
Q5ZCI1Oryza sativa subsp. japonicasp|Q5ZCI1|MPK10_ORYSJ Mitogen-activated protein kinase 1071.500%Swiss-ProtHigh
Q5SN53Oryza sativa subsp. japonicasp|Q5SN53|MPK8_ORYSJ Mitogen-activated protein kinase 880.900%Swiss-ProtHigh

JBrowse

View in Genome Browser