TkA02G105950 | RubberDandelionOmics

Gene overview

TkA02G105950

Reference: TK1151 Chr: Chr02 Coordinates: 27742977-27744013 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

873 bp · TkA02G105950|TK1151|cDNA

GCGGACGTCCTCTCTCGTGTGTCACCTCGGGATGTGTGCCGGTTTACGGTGACGGCTTCCGCAATTAGAGATGCTGTAGAGTCGGAGGTGTTGTGGGATAAGTTATTGCCACCCCATTATCAAGAAATCATATCAAGAAGTGTGTCTCCATTGACGTTCAAATCCAAGAAGGATCTCTTCTTTAAGCTTTCTTCTCCTTTTCTCATTGATGGTGGCCTAAAGACATTCTCGATACAGAAAGCGACAGGAAAAAAGTGTTA...

CDS

Download CDS FASTA

792 bp · TkA02G105950|TK1151|CDS

GCGGACGTCCTCTCTCGTGTGTCACCTCGGGATGTGTGCCGGTTTACGGTGACGGCTTCCGCAATTAGAGATGCTGTAGAGTCGGAGGTGTTGTGGGATAAGTTATTGCCACCCCATTATCAAGAAATCATATCAAGAAGTGTGTCTCCATTGACGTTCAAATCCAAGAAGGATCTCTTCTTTAAGCTTTCTTCTCCTTTTCTCATTGATGGTGGCCTAAAGACATTCTCGATACAGAAAGCGACAGGAAAAAAGTGTTA...

Protein

Download Protein FASTA

263 aa · TkA02G105950|TK1151|PROTEIN

ADVLSRVSPRDVCRFTVTASAIRDAVESEVLWDKLLPPHYQEIISRSVSPLTFKSKKDLFFKLSSPFLIDGGLKTFSIQKATGKKCYMLSARDLYIAWSANSLFWCWKPLTKSRFSEAVELRMTSWLEIVGKINTRSLSPNTHYGAYLITEVARYRAFGLDALPCEVSVEVGEYRSQGKIIFSHNKCSNPCRLDEYKKGLRSKFGEEISSVCYEREDGWLEIELGGFYNDGSCDKEVKMSLREVNGVHLKGGLIVEGIEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G105950`
TK1151 ID	TkA02G105950
OH-1004 ID	LXL04_016746
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	98.900
Protein coverage (%)	TK1151 99.620 / OH-1004 96.324 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G105950

Location Chr02:27742977-27744013 (-)

Description Similar to PP2B15: F-box protein PP2-B15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09155`	F-box protein PP2-B15.	No verified direct reference in this release
`At1g56240`	F-box protein PP2-B13.	No verified direct reference in this release
`At1g56250`	Component of SCF(VBF) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins such as VIP1 and Agrobacterium virE2, after their implication in T-DNA translocation to the host nucleus (can functionally replace Agrobacterium VirF).	No verified direct reference in this release
`At2g02240`	F-box protein At2g02240.	No verified direct reference in this release
`At2g02360`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016746 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0030246 carbohydrate binding Molecular Function

KEGG gene cross-reference

ath:AT1G09155

ath:AT1G56240

ath:AT1G56250

ath:AT2G02240

ath:AT2G02360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.553

Rank 1 · TkA02G105950 · TK1151

Cytoplasm0.532

Rank 2 · TkA02G105950 · TK1151

Cell membrane0.066

Rank 3 · TkA02G105950 · TK1151

Endoplasmic reticulum0.061

Rank 4 · TkA02G105950 · TK1151

Lysosome / Vacuole0.032

Rank 5 · TkA02G105950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12937F-box-like2-35 aa

PF00646F-box3-33 aa

PF14299PP284-262 aa

PF12937F-box-like161-171 aa

PF24552Defensin182-199 aa

PF24552Defensin228-236 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G105950	`PF12937`	F-box-like	2	35	0.027	14.9
TkA02G105950	`PF00646`	F-box	3	33	0.094	13.4
TkA02G105950	`PF14299`	PP2	84	262	9.4e-49	165.9
TkA02G105950	`PF12937`	F-box-like	161	171	0.027	14.9
TkA02G105950	`PF24552`	Defensin	182	199	0.17	12.7
TkA02G105950	`PF24552`	Defensin	228	236	0.17	12.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80494`	Arabidopsis thaliana	sp\|O80494\|P2B15_ARATH F-box protein PP2-B15	45.600%	Swiss-Prot	Medium
`Q9C7J9`	Arabidopsis thaliana	sp\|Q9C7J9\|P2B13_ARATH F-box protein PP2-B13	41.100%	Swiss-Prot	Medium
`Q9C7K0`	Arabidopsis thaliana	sp\|Q9C7K0\|VBF_ARATH F-box protein VBF	40.500%	Swiss-Prot	Medium
`Q3E6P4`	Arabidopsis thaliana	sp\|Q3E6P4\|FB95_ARATH F-box protein At2g02240	39.500%	Swiss-Prot	Medium
`Q9ZVQ6`	Arabidopsis thaliana	sp\|Q9ZVQ6\|P2B10_ARATH F-box protein PP2-B10	37.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card