TkA02G103280 | RubberDandelionOmics

Gene overview

TkA02G103280

Reference: TK1151 Chr: Chr02 Coordinates: 27023453-27033151 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3255 bp · TkA02G103280|TK1151|cDNA

TTTAAAAAACTGTTTGGATGATTCTCCATTTCCATAGACGGATTACTTAATTTGTCCCTTTCCTTACGTACGAACGTTATAAATTTTTCATGTGCATTTTATAACTAGTTAGATACAAAATTTAATCCCCATTACTTCGTTCACCTACGACACGATTTTAACAAATTAAAGATATAATTCTGTCGTATATCTAAAACAAAGAATTTTTTTACCGAAACTAGTCAAATATTTATTCTCACTGTTTTAGTATTTTCTCACAA...

CDS

Download CDS FASTA

1848 bp · TkA02G103280|TK1151|CDS

ATGGGAAGTGTTTATGCATACGGGGCAAAACTCCTATCTCAAGGGTTACTTCCTGGCTTCGAGGCTATTTTTGACAAAATATCGGACAAAATAGTCGGCACGCTTGAGAATATTTTACAAACCAAGTTTGCGAATGTATCCAGCAACACTTTTAATGAGTTTTCATCGTTTGACGATGTGCTTAAGCTTTATAAAGGCGGGCTTCCATTACCAAAATCTGATTTTCTTGAAAGCCTTCGGGAGAAGATTCCGTTTGAGTT...

Protein

Download Protein FASTA

615 aa · TkA02G103280|TK1151|PROTEIN

MGSVYAYGAKLLSQGLLPGFEAIFDKISDKIVGTLENILQTKFANVSSNTFNEFSSFDDVLKLYKGGLPLPKSDFLESLREKIPFEFLRELLRSDGEQLLKFPTPQVIQGDESAWMKDEEFGREMLAGINPVVIRRLQEFPPCSKLDPIKFGNQNSTMSIDHIKDQLDGLSVLEAINNNKLFILDHHDPLMPYLRGINETTTKIYATRTILFLKKDGTLKPVAIELSLPHPDGDEFGVISTVHTPALEGIKGTIWLLAKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G103280`
TK1151 ID	TkA02G103280
OH-1004 ID	LXL04_016782
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 68.993 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G103280

Location Chr02:27023453-27033151 (-)

Description Similar to LOX1.5: Probable linoleate 9S-lipoxygenase 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g22400`	9S-lipoxygenase that can use linoleic acid or linolenic acid as substrates.	Facilitation of Fusarium graminearum Infection by 9-Lipoxygenases in Arabidopsis and Wheat.2015 · DOI: 10.1094/mpmi-04-15-0096-r Enzymatic and Non-Enzymatic Mechanisms Contribute to Lipid Oxidation During Seed Aging.2017 · DOI: 10.1093/pcp/pcx036

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016782 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0031408 oxylipin biosynthetic process Biological Process

GO:0034440 lipid oxidation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0016165 linoleate 13S-lipoxygenase activity Molecular Function

GO:0016702 oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:1990136 linoleate 9S-lipoxygenase activity Molecular Function

KEGG gene cross-reference

ag:AAB31252

sly:543994

sot:102577714

sot:102602528

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.375

Rank 1 · TkA02G103280 · TK1151

Lysosome / Vacuole0.169

Rank 2 · TkA02G103280 · TK1151

Endoplasmic reticulum0.155

Rank 3 · TkA02G103280 · TK1151

Extracellular0.116

Rank 4 · TkA02G103280 · TK1151

Cell membrane0.104

Rank 5 · TkA02G103280 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00305Lipoxygenase30-598 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G103280	`PF00305`	Lipoxygenase	30	598	3.8e-255	849.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LUW0`	Arabidopsis thaliana	sp\|Q9LUW0\|LOX5_ARATH Linoleate 9S-lipoxygenase 5	66.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card