TkA02G086010 | RubberDandelionOmics

Gene overview

TkA02G086010

Reference: TK1151 Chr: Chr02 Coordinates: 22347920-22355898 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3298 bp · TkA02G086010|TK1151|cDNA

GTAATATATATTTTTGTTAACATAGGTGTCATGAAATTATTATTGTTTTTAAGATTTGGGGTATTCTTTTGTCTTTGGATCCTTGAAGACAAAAAGAGACACCATAAGTATACGTAGGTTAAGAAAATGACAGAAATTATGCCATGTGTCGTCAGAGATTCCTGAAGACAAACTCTGCCCCACGTATACCTTCTTCCTTCTTCTTGCCTTCATCTTCACGAGTCAAAAAACCATTCGAGCTTCCTCCATCCTTCACACAC...

CDS

Download CDS FASTA

2148 bp · TkA02G086010|TK1151|CDS

ATGGGGTGTATGTGCTCGAAAGGAATTTCAACAAACGAGTACGCAGAGAAAGAATCAAAGAGATCGTCCAAACGCTTTCTCGGTTCTTCAAGGAGGGACGAAGTTGCAGTCGAGGTCGACAATGGCGGCAATGATGCTGCTACTACCAGACTTATCTCAGAGGATAACAGAGAACACACAGCAAGTTCACGGCAAACACCATGGGAACAACAAAAAGAAGAAGAAGAAGAGAGAAAGAGCGTGGTTTATGAACAAGTACA...

Protein

Download Protein FASTA

715 aa · TkA02G086010|TK1151|PROTEIN

MGCMCSKGISTNEYAEKESKRSSKRFLGSSRRDEVAVEVDNGGNDAATTRLISEDNREHTASSRQTPWEQQKEEEEERKSVVYEQVQVQVKSQVQPLVQLSQNPIEAKGNGDIHIQQPEICRIYNVANGVDVTQEAAGWPSWLTAVAGEAIKGLLPRKADSFEKLDKIGQGTYSSVYRARDLESGKIVALKKVRFTKMDPESVRFMAREIIVLRRLDHPNVMKLEGLLTSRVSGNLYLVFDYMEHDLAGLAASPIIKFTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G086010`
TK1151 ID	TkA02G086010
OH-1004 ID	LXL04_016980
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G086010

Location Chr02:22347920-22355898 (+)

Description Similar to At1g09600: Probable serine/threonine-protein kinase At1g09600

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g09600`	Probable serine/threonine-protein kinase At1g09600.	No verified direct reference in this release
`At1g54610`	Probable serine/threonine-protein kinase At1g54610.	No verified direct reference in this release
`At1g18670`	Required for beta-aminobutyric acid (BABA)-induced resistance (BABA-IR) against bacteria (e.g. P.syringae) and oomycetes (e.g. H.parasitica) via priming for salicylate (SA)-dependent defense responses such as pathogenesis-related PR-1 gene expression and trailing necrosis.	Dissecting the beta-aminobutyric acid-induced priming phenomenon in Arabidopsis.2005 · DOI: 10.1105/tpc.104.029728 Descendants of primed Arabidopsis plants exhibit resistance to biotic stress.2012 · DOI: 10.1104/pp.111.191593
`At5g39420`	Cyclin-dependent kinase C-2 C.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0958000`	Cyclin-dependent kinase C-2.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016980 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002229 defense response to oomycetes Biological Process

GO:0009615 response to virus Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:1900426 positive regulation of defense response to bacterium Biological Process

GO:1902290 positive regulation of defense response to oomycetes Biological Process

GO:2000031 regulation of salicylic acid mediated signaling pathway Biological Process

GO:0000307 cyclin-dependent protein kinase holoenzyme complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004693 cyclin-dependent protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G09600

ath:AT1G18670

ath:AT1G54610

ath:AT5G39420

dosa:Os01g0958000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.459

Rank 1 · TkA02G086010 · TK1151

Cytoplasm0.421

Rank 2 · TkA02G086010 · TK1151

Nucleus0.265

Rank 3 · TkA02G086010 · TK1151

Golgi apparatus0.063

Rank 4 · TkA02G086010 · TK1151

Endoplasmic reticulum0.051

Rank 5 · TkA02G086010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase65-93 aa

PF00069Pkinase162-447 aa

PF03109ABC1162-194 aa

PF07714PK_Tyr_Ser-Thr165-376 aa

PF01636APH168-244 aa

PF01636APH206-308 aa

PF03109ABC1274-320 aa

PF14531Kinase-like274-336 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G086010	`PF00069`	Pkinase	65	93	1.8e-65	221.7
TkA02G086010	`PF00069`	Pkinase	162	447	1.8e-65	221.7
TkA02G086010	`PF03109`	ABC1	162	194	0.0024	17.8
TkA02G086010	`PF07714`	PK_Tyr_Ser-Thr	165	376	3.5e-29	102.6
TkA02G086010	`PF01636`	APH	168	244	0.14	12.6
TkA02G086010	`PF01636`	APH	206	308	0.14	12.6
TkA02G086010	`PF03109`	ABC1	274	320	0.0024	17.8
TkA02G086010	`PF14531`	Kinase-like	274	336	0.06	13.3
TkA02G086010	`PF07387`	Seadorna_VP7	274	304	0.096	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I114`	Arabidopsis thaliana	sp\|F4I114\|Y1960_ARATH Probable serine/threonine-protein kinase At1g09600	58.700%	Swiss-Prot	High
`Q9ZVM9`	Arabidopsis thaliana	sp\|Q9ZVM9\|Y1461_ARATH Probable serine/threonine-protein kinase At1g54610	67.200%	Swiss-Prot	Medium
`F4ICB6`	Arabidopsis thaliana	sp\|F4ICB6\|IBS1_ARATH Protein IMPAIRED IN BABA-INDUCED STERILITY 1	63.600%	Swiss-Prot	Medium
`B5X564`	Arabidopsis thaliana	sp\|B5X564\|CDC2C_ARATH Cyclin-dependent kinase C-2 C	63.400%	Swiss-Prot	Low
`Q5JK68`	Oryza sativa subsp. japonica	sp\|Q5JK68\|CDKC2_ORYSJ Cyclin-dependent kinase C-2	54.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card