TkA02G082440 | RubberDandelionOmics

Gene overview

TkA02G082440

Reference: TK1151 Chr: Chr02 Coordinates: 21422393-21425929 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2462 bp · TkA02G082440|TK1151|cDNA

TTCCACCTCCCCTGGTTTGTTGAGCTGGATTTAATGTTCGCTTTGAGTCCGAAGAAGAAGAAATCGATTTAGACCAAGAGTATATGCTTTTTGATCTACTTCTTCCCTTCCACCTGTTTGTAGAAAGTTCTAAAGTCTAAAATATTCTCGAAATTATCATACCTAACGTCTAATGTTCAAGGATTTCAAGATCTTGGTTGCGGCTATTGCAGTTCAGATTTGATGGAATCTTAGCTTTTCACCTAACAGGGGGAAAAAAC...

CDS

Download CDS FASTA

1266 bp · TkA02G082440|TK1151|CDS

ATGTCTTTCAGAAGCATAGTTCGTGATGTGAGAGATGGAATTGGGAGTCTATCGAGGCGGGGTTTTGAAGTGAGGCTTAACAGAGGGAAATCGCAAGGCTCGGTTAATGTCTTAGATGATAATAATCATTCGTCTGTAGTGATTCAGACCAGTAGGTGGGCGAATTTACCACCTGAACTTCTTTTCGACGTGATTAAAAGATTGGAAGAGAGCGAAAGCAGTTGGCCTGCGAGAAAACATGTGGTGGCTTGTGCGGCGGT...

Protein

Download Protein FASTA

421 aa · TkA02G082440|TK1151|PROTEIN

MSFRSIVRDVRDGIGSLSRRGFEVRLNRGKSQGSVNVLDDNNHSSVVIQTSRWANLPPELLFDVIKRLEESESSWPARKHVVACAAVCRSWRSMCKEIVRTPESCGKLTFPVSMKQPGTREGTIQCFIKRDKSNLTYHLYLCLSPAALLVENGKFLLSAKRTRRTTCTEYVISMDPENISRSSSTYIGKLRSNFLGTKFIIYDTQPPHFNTPLPRVTSKRFDSKKVSPKPPAGSHDIAHITYELNVLGTRGPRRMHCIMQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G082440`
TK1151 ID	TkA02G082440
OH-1004 ID	LXL04_038705
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	80.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G082440

Location Chr02:21422393-21425929 (+)

Description Similar to TULP8: Tubby-like F-box protein 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g25280`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At1g76900`	Tubby-like F-box protein 1.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0437900`	Tubby-like F-box protein 8.	No verified direct reference in this release
`Os12g0163400`	Tubby-like F-box protein 14.	No verified direct reference in this release
`Os08g0103300`	Tubby-like F-box protein 12.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038705 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009620 response to fungus Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G25280

ath:AT1G76900

dosa:Os04g0687900

dosa:Os05g0437900

dosa:Os12g0163400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.460

Rank 1 · TkA02G082440 · TK1151

Nucleus0.371

Rank 2 · TkA02G082440 · TK1151

Cell membrane0.361

Rank 3 · TkA02G082440 · TK1151

Endoplasmic reticulum0.053

Rank 4 · TkA02G082440 · TK1151

Golgi apparatus0.041

Rank 5 · TkA02G082440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box2-11 aa

PF12937F-box-like53-96 aa

PF00646F-box53-96 aa

PF01167Tub114-416 aa

PF12043DUF3527182-228 aa

PF12043DUF3527383-412 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G082440	`PF00646`	F-box	2	11	8.9e-05	23.0
TkA02G082440	`PF12937`	F-box-like	53	96	2.6e-07	31.0
TkA02G082440	`PF00646`	F-box	53	96	8.9e-05	23.0
TkA02G082440	`PF01167`	Tub	114	416	8.4e-106	354.0
TkA02G082440	`PF12043`	DUF3527	182	228	0.026	14.8
TkA02G082440	`PF12043`	DUF3527	383	412	0.026	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FRH7`	Arabidopsis thaliana	sp\|Q9FRH7\|TLP10_ARATH Tubby-like F-box protein 10	69.700%	Swiss-Prot	High
`Q9ZP59`	Arabidopsis thaliana	sp\|Q9ZP59\|TLP1_ARATH Tubby-like F-box protein 1	68.200%	Swiss-Prot	High
`Q75HX5`	Oryza sativa subsp. japonica	sp\|Q75HX5\|TLP8_ORYSJ Tubby-like F-box protein 8	68.400%	Swiss-Prot	High
`Q2QXB2`	Oryza sativa subsp. japonica	sp\|Q2QXB2\|TLP14_ORYSJ Tubby-like F-box protein 14	67.500%	Swiss-Prot	High
`Q69U54`	Oryza sativa subsp. japonica	sp\|Q69U54\|TLP12_ORYSJ Tubby-like F-box protein 12	66.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card