TkA02G060230 | RubberDandelionOmics

Gene overview

TkA02G060230

Reference: TK1151 Chr: Chr02 Coordinates: 15681629-15692372 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1549 bp · TkA02G060230|TK1151|cDNA

CAAAGAGGAGCTAAGAAATCATGTCGTCGGAGAAAACTATATCAACCGGCGCCGGAAACCTTCACGTCGTCTTCCTCCCTTTCTTCACTTCTAGTCACATAATCCCTTTAGTCCACGCCGCCAGGCTCTTCGCCGCCCAAGGCGTTCGCTCCACCATCATCACATCAGTTCACAATGCTCTCATATTTAAATCCTCCGTTGACCATGATATCTCCGCCGGAATCCCCATCGCCGTTCAGACCATAACCTTCCCAGCATCG...

CDS

Download CDS FASTA

1464 bp · TkA02G060230|TK1151|CDS

ATGTCGTCGGAGAAAACTATATCAACCGGCGCCGGAAACCTTCACGTCGTCTTCCTCCCTTTCTTCACTTCTAGTCACATAATCCCTTTAGTCCACGCCGCCAGGCTCTTCGCCGCCCAAGGCGTTCGCTCCACCATCATCACATCAGTTCACAATGCTCTCATATTTAAATCCTCCGTTGACCATGATATCTCCGCCGGAATCCCCATCGCCGTTCAGACCATAACCTTCCCAGCATCGGAGGTCGGACTGCCTATTGG...

Protein

Download Protein FASTA

487 aa · TkA02G060230|TK1151|PROTEIN

MSSEKTISTGAGNLHVVFLPFFTSSHIIPLVHAARLFAAQGVRSTIITSVHNALIFKSSVDHDISAGIPIAVQTITFPASEVGLPIGLESLNAATDLNMASKIYRGMLLLQTPIEQLIRNLAPDCIFSDMFFPWTADLADELKIPRLLFYPSCFLYHSVSHSLRVHEPHEKVKSESETFVVPDLPDEITMKRSQVSDQFKFKTPMGEIMKTIIQSESRSYGLVHNTFYEIEPAYVDHMKKIKGTDKIWHIGPLFKFFLQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G060230`
TK1151 ID	TkA02G060230
OH-1004 ID	LXL04_017289
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G060230`
Location	Chr02:15681629-15692372 (+)
Description	Similar to GmSGT2: Soyasapogenol B glucuronide galactosyltransferase
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_017289` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0008202 steroid metabolic process Biological Process GO:0016104 triterpenoid biosynthetic process Biological Process GO:0016135 saponin biosynthetic process Biological Process GO:0008194 UDP-glycosyltransferase activity Molecular Function GO:0035251 UDP-glucosyltransferase activity Molecular Function GO:0042802 identical protein binding Molecular Function GO:0047248 nuatigenin 3-beta-glucosyltransferase activity Molecular Function GO:0050275 scopoletin glucosyltransferase activity Molecular Function GO:0102240 soyasapogenol B glucuronide galactosyltransferase activity Molecular Function
KEGG gene cross-reference	ag:BAI99584 gmx:100777250 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.826

Rank 1 · TkA02G060230 · TK1151

Nucleus0.209

Rank 2 · TkA02G060230 · TK1151

Endoplasmic reticulum0.056

Rank 3 · TkA02G060230 · TK1151

Peroxisome0.051

Rank 4 · TkA02G060230 · TK1151

Mitochondrion0.038

Rank 5 · TkA02G060230 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N16-253 aa

PF00201UDPGT119-167 aa

PF02946GTF2I164-194 aa

PF19575HTH_58191-229 aa

PF00201UDPGT282-407 aa

PF02946GTF2I313-333 aa

PF06722EryCIII-like_C341-411 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G060230	`PF26168`	Glyco_transf_N	16	253	6.2e-05	23.7
TkA02G060230	`PF00201`	UDPGT	119	167	2e-22	80.4
TkA02G060230	`PF02946`	GTF2I	164	194	0.092	13.8
TkA02G060230	`PF19575`	HTH_58	191	229	0.029	15.0
TkA02G060230	`PF00201`	UDPGT	282	407	2e-22	80.4
TkA02G060230	`PF02946`	GTF2I	313	333	0.092	13.8
TkA02G060230	`PF06722`	EryCIII-like_C	341	411	0.017	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card