TkA02G054920 | RubberDandelionOmics

Gene overview

TkA02G054920

Reference: TK1151 Chr: Chr02 Coordinates: 14352040-14353433 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

727 bp · TkA02G054920|TK1151|cDNA

TATCTACATTTCATTCCGGCTAAACAGGTATTTCCAACTACAATCAAGCTTTAAGCAAGGACAGTTGGAGAAATCGGAGAGAGGGAGAGACTGTGTGATTGTTTTTATTGAAATTTCAATTAGGGATTGCTTCGATTAAATTGAGTTTTTATTATTTATCTTCGAGTACCAATTAGGGCGCAGGTGCGTTATTGTGTTGAAGAATAAACGTTAATTCATATTGAAGATGGATTCAGAAGATGATATGCACGACGCGAACG...

CDS

Download CDS FASTA

501 bp · TkA02G054920|TK1151|CDS

ATGGATTCAGAAGATGATATGCACGACGCGAACGATGCCGAGTCTCTTGATGATGACTTCTACAGTGGGGAGACTGTGATGGACTCCGATGATGGTGATGCAGCGGACTACGAGTTCATCGACGATGATTCCGATGATTCTGATGATCTCCTTTCTCGTCGTAGCCAGCAAAACTACACCATTCTAAATGAATCTGATATTCATCTACGTCAAGAGGATGATATCATGAAGATATCTTCCATACTTTCCATTTCCAGTGT...

Protein

Download Protein FASTA

166 aa · TkA02G054920|TK1151|PROTEIN

MDSEDDMHDANDAESLDDDFYSGETVMDSDDGDAADYEFIDDDSDDSDDLLSRRSQQNYTILNESDIHLRQEDDIMKISSILSISSVAAAILLRHYNWSVSKVNDEWFADEEKVRRVVGLLEDPRALPNVKESTCGICFEVYSSDSMRSAACGHPFCVTCWQGLFF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G054920`
TK1151 ID	TkA02G054920
OH-1004 ID	LXL04_017314
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 98.193 / OH-1004 93.678 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G054920

Location Chr02:14352040-14353433 (-)

Description Similar to ARI7: Probable E3 ubiquitin-protein ligase ARI7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g65430`	Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.	No verified direct reference in this release
`At2g31510`	Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.	No verified direct reference in this release
`At1g05890`	Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.	No verified direct reference in this release
`At1g63760`	Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.	No verified direct reference in this release
`At2g31770`	Might act as an E3 ubiquitin-protein ligase, or as part of E3 complex, which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017314 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0000151 ubiquitin ligase complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0031624 ubiquitin conjugating enzyme binding Molecular Function

GO:0061630 ubiquitin protein ligase activity Molecular Function

KEGG gene cross-reference

ath:AT1G05890

ath:AT1G65430

ath:AT2G31510

ath:AT2G31780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.748

Rank 1 · TkA02G054920 · TK1151

Cytoplasm0.427

Rank 2 · TkA02G054920 · TK1151

Mitochondrion0.030

Rank 3 · TkA02G054920 · TK1151

Cell membrane0.026

Rank 4 · TkA02G054920 · TK1151

Endoplasmic reticulum0.023

Rank 5 · TkA02G054920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10446DUF24573-89 aa

PF25624PH_S11IP_C54-122 aa

PF21235UBA_ARI171-108 aa

PF26000UBA_ARIH2_N73-105 aa

PF16366CEBP_ZZ128-162 aa

PF13920zf-C3HC4_3132-164 aa

PF13639zf-RING_2134-162 aa

PF24921RING_XB3-XBAT31134-162 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G054920	`PF10446`	DUF2457	3	89	2.2	8.1
TkA02G054920	`PF25624`	PH_S11IP_C	54	122	0.032	15.1
TkA02G054920	`PF21235`	UBA_ARI1	71	108	2.4e-10	40.7
TkA02G054920	`PF26000`	UBA_ARIH2_N	73	105	0.0017	19.0
TkA02G054920	`PF16366`	CEBP_ZZ	128	162	0.069	14.1
TkA02G054920	`PF13920`	zf-C3HC4_3	132	164	0.11	13.0
TkA02G054920	`PF13639`	zf-RING_2	134	162	0.00029	21.7
TkA02G054920	`PF24921`	RING_XB3-XBAT31	134	162	0.00076	20.2
TkA02G054920	`PF13923`	zf-C3HC4_2	135	162	2.2e-05	24.8
TkA02G054920	`PF14634`	zf-RING_5	135	163	0.00037	21.1
TkA02G054920	`PF13445`	zf-RING_UBOX	135	160	0.00042	21.0
TkA02G054920	`PF00097`	zf-C3HC4	135	161	0.00097	19.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W468`	Arabidopsis thaliana	sp\|Q8W468\|ARI8_ARATH Probable E3 ubiquitin-protein ligase ARI8	61.400%	Swiss-Prot	High
`Q84RR0`	Arabidopsis thaliana	sp\|Q84RR0\|ARI7_ARATH Probable E3 ubiquitin-protein ligase ARI7	54.800%	Swiss-Prot	High
`Q8L829`	Arabidopsis thaliana	sp\|Q8L829\|ARI5_ARATH Probable E3 ubiquitin-protein ligase ARI5	53.700%	Swiss-Prot	High
`P0C8K8`	Arabidopsis thaliana	sp\|P0C8K8\|ARI6_ARATH Putative E3 ubiquitin-protein ligase ARI6	48.000%	Swiss-Prot	Medium
`Q9SKC3`	Arabidopsis thaliana	sp\|Q9SKC3\|ARI9_ARATH Probable E3 ubiquitin-protein ligase ARI9	50.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card