TkA02G047930 | RubberDandelionOmics

Gene overview

TkA02G047930

Reference: TK1151 Chr: Chr02 Coordinates: 12455916-12457484 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · TkA02G047930|TK1151|cDNA

ATGAATGTACGCAAGAGGGCTGACCATTTGGGTATCCAATATAAGTTCCCTGGTGAGACAAACTATTCGATGTTGTTTTTAGCACATGCGAGAGAAGATGGATGGTTGACGACTGAATTGTATCAGTTTATTAACGACACGAGTAATGTTGACCTTGAAATTGAGTTCGATTGTGCACATGGGATTGAAGTAGAAGGCGTTGAGTTTGTGCCCGTGGAGAAAGTAAATGATGAAGATGATGATGATGATAATGAGGAGGA...

CDS

Download CDS FASTA

918 bp · TkA02G047930|TK1151|CDS

ATGAATGTACGCAAGAGGGCTGACCATTTGGGTATCCAATATAAGTTCCCTGGTGAGACAAACTATTCGATGTTGTTTTTAGCACATGCGAGAGAAGATGGATGGTTGACGACTGAATTGTATCAGTTTATTAACGACACGAGTAATGTTGACCTTGAAATTGAGTTCGATTGTGCACATGGGATTGAAGTAGAAGGCGTTGAGTTTGTGCCCGTGGAGAAAGTAAATGATGAAGATGATGATGATGATAATGAGGAGGA...

Protein

Download Protein FASTA

305 aa · TkA02G047930|TK1151|PROTEIN

MNVRKRADHLGIQYKFPGETNYSMLFLAHAREDGWLTTELYQFINDTSNVDLEIEFDCAHGIEVEGVEFVPVEKVNDEDDDDDNEEEEDEETYWEKKLPSDYKRIILWGEESLQQATKKELYSIFCKGFQFYFTGEQISLEKNGKKCHMLSARKALGGVTCPCVWQSLPESRFGEVATDPSGDLWILCSSDYLSPKTTYATNLVYKLQENHSWFEHPVVCKRILYPEPDPCPWVICLLSTQAPDITGKFYRKKSLPQQRN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G047930`
TK1151 ID	TkA02G047930
OH-1004 ID	LXL04_017356
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	79.500
Protein coverage (%)	TK1151 100.000 / OH-1004 42.940 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G047930

Location Chr02:12455916-12457484 (+)

Description Similar to At5g38990: Probable receptor-like protein kinase At5g38990

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g56250`	Component of SCF(VBF) E3 ubiquitin ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins such as VIP1 and Agrobacterium virE2, after their implication in T-DNA translocation to the host nucleus (can functionally replace Agrobacterium VirF).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017356 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009723 response to ethylene Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009741 response to brassinosteroid Biological Process

GO:0009742 brassinosteroid mediated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010038 response to metal ion Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

KEGG gene cross-reference

ath:AT3G04690

ath:AT3G46290

ath:AT3G51550

ath:AT5G38990

ath:AT5G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.575

Rank 1 · TkA02G047930 · TK1151

Nucleus0.430

Rank 2 · TkA02G047930 · TK1151

Cell membrane0.119

Rank 3 · TkA02G047930 · TK1151

Endoplasmic reticulum0.085

Rank 4 · TkA02G047930 · TK1151

Extracellular0.066

Rank 5 · TkA02G047930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14299PP226-71 aa

PF24639DUF763427-54 aa

PF15313HEXIM76-122 aa

PF14299PP2145-304 aa

PF24639DUF7634258-282 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G047930	`PF14299`	PP2	26	71	2.1e-20	73.9
TkA02G047930	`PF24639`	DUF7634	27	54	0.03	15.4
TkA02G047930	`PF15313`	HEXIM	76	122	0.042	14.8
TkA02G047930	`PF14299`	PP2	145	304	2.1e-20	73.9
TkA02G047930	`PF24639`	DUF7634	258	282	0.03	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C7K0`	Arabidopsis thaliana	sp\|Q9C7K0\|VBF_ARATH F-box protein VBF	25.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card