TkA02G039300 | RubberDandelionOmics

Gene overview

TkA02G039300

Reference: TK1151 Chr: Chr02 Coordinates: 9933482-9934950 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1231 bp · TkA02G039300|TK1151|cDNA

ATTTGTTTATACACCTTTGACATTTCTCCTTTGTGTGTGTGTGTGAGTGAGAGAGAGAGATGGGGTTCTTGTTTGCAATATTAACTCGATTGCTTCATGGACTCATGCAGCTTGCAGGGCTAACACCCCAAACTCTAGAAATAGAGCCTGGAACCCTCATGAACATATGGATTCCAAAAGAAACAATCGTCAAAATTGACGGAAAACACCATTACAGACCACCCAACAAACCCGCTGTCCTCCTTCTCCATTGTTTCGCC...

CDS

Download CDS FASTA

927 bp · TkA02G039300|TK1151|CDS

ATGGGGTTCTTGTTTGCAATATTAACTCGATTGCTTCATGGACTCATGCAGCTTGCAGGGCTAACACCCCAAACTCTAGAAATAGAGCCTGGAACCCTCATGAACATATGGATTCCAAAAGAAACAATCGTCAAAATTGACGGAAAACACCATTACAGACCACCCAACAAACCCGCTGTCCTCCTTCTCCATTGTTTCGCCATGGACGGCATCTTCCTCTGGTTTCCACAAGTTTTATCCCTACGCAAAACCTACTCTGT...

Protein

Download Protein FASTA

308 aa · TkA02G039300|TK1151|PROTEIN

MGFLFAILTRLLHGLMQLAGLTPQTLEIEPGTLMNIWIPKETIVKIDGKHHYRPPNKPAVLLLHCFAMDGIFLWFPQVLSLRKTYSVYVPDFLFFGGSTTTRTERSPAFQAEFLAKGMKILQVEKVALVGLSYGGIVGFVMAKLYPNLVHSMMVSSTVIELTESSSRESLKQIGLSSWPALLLPETMEGFIRMFNVGAHKLLWLPDFIYRGTFETMFTNRKERSELLTAMIVPNKDANMDTNNYSHQRIHMLWGEDDKIF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G039300`
TK1151 ID	TkA02G039300
OH-1004 ID	LXL04_001712
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	66.400
Protein coverage (%)	TK1151 99.675 / OH-1004 98.706 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA02G039300`
Location	Chr02:9933482-9934950 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_001712` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0046464 acylglycerol catabolic process Biological Process GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0016787 hydrolase activity Molecular Function GO:0047372 monoacylglycerol lipase activity Molecular Function
KEGG gene cross-reference	mbo:BQ2027_MB2734 mtc:MT2788 mtu:Rv2715 mtv:RVBD_2715 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.596

Rank 1 · TkA02G039300 · TK1151

Cytoplasm0.174

Rank 2 · TkA02G039300 · TK1151

Cell membrane0.102

Rank 3 · TkA02G039300 · TK1151

Mitochondrion0.095

Rank 4 · TkA02G039300 · TK1151

Nucleus0.094

Rank 5 · TkA02G039300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00561Abhydrolase_158-291 aa

PF12697Abhydrolase_660-296 aa

PF08840BAAT_C74-100 aa

PF05577Peptidase_S28112-161 aa

PF00326Peptidase_S9112-170 aa

PF00756Esterase114-265 aa

PF08840BAAT_C122-179 aa

PF12146Hydrolase_4123-292 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G039300	`PF00561`	Abhydrolase_1	58	291	1.1e-16	61.9
TkA02G039300	`PF12697`	Abhydrolase_6	60	296	2.5e-10	42.1
TkA02G039300	`PF08840`	BAAT_C	74	100	0.029	15.1
TkA02G039300	`PF05577`	Peptidase_S28	112	161	0.024	14.2
TkA02G039300	`PF00326`	Peptidase_S9	112	170	0.28	11.4
TkA02G039300	`PF00756`	Esterase	114	265	0.019	15.5
TkA02G039300	`PF08840`	BAAT_C	122	179	0.029	15.1
TkA02G039300	`PF12146`	Hydrolase_4	123	292	0.0002	21.5
TkA02G039300	`PF15061`	MITRAC7_Phoenixin	133	157	0.021	15.2
TkA02G039300	`PF00326`	Peptidase_S9	261	289	0.28	11.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card