TkA02G029680 | RubberDandelionOmics

Gene overview

TkA02G029680

Reference: TK1151 Chr: Chr02 Coordinates: 7187678-7188723 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

642 bp · TkA02G029680|TK1151|cDNA

ATGAGGTGGACGAGAGGCAATGTTCTTGGCCGGGGATCCTCCGCCACCGTCTCCACCGCCACCTCCGCCACCACCGGAGAGATTTTTGCCGTCAAGTCCGTTGATTTATCAAAGTCGGAGACTTTACAGAGAGAACAAAAGTTTCTTTCCATTTTGAGTAGTCCTTATGTGGTAACTTATAAAGGGTACGACATTTCTAGAGAAGAAAACAGGATAATGTACAACTTACTAATGCAGTACATGCCAGAAGGTACTGTTAT...

CDS

Download CDS FASTA

642 bp · TkA02G029680|TK1151|CDS

ATGAGGTGGACGAGAGGCAATGTTCTTGGCCGGGGATCCTCCGCCACCGTCTCCACCGCCACCTCCGCCACCACCGGAGAGATTTTTGCCGTCAAGTCCGTTGATTTATCAAAGTCGGAGACTTTACAGAGAGAACAAAAGTTTCTTTCCATTTTGAGTAGTCCTTATGTGGTAACTTATAAAGGGTACGACATTTCTAGAGAAGAAAACAGGATAATGTACAACTTACTAATGCAGTACATGCCAGAAGGTACTGTTAT...

Protein

Download Protein FASTA

213 aa · TkA02G029680|TK1151|PROTEIN

MRWTRGNVLGRGSSATVSTATSATTGEIFAVKSVDLSKSETLQREQKFLSILSSPYVVTYKGYDISREENRIMYNLLMQYMPEGTVIDAIKVRNCDLVNEFEISNYTRQIIQGLEYLHSYGVVHCDIKGANLLVGDNGVKIGDFGCAKWASESVASVVTDLIEQPCSTYSLRRRIEQLAGNSEKEKWRLEVEVEEEIDWMTIRSNESSGRWRR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G029680`
TK1151 ID	TkA02G029680
OH-1004 ID	LXL04_038177
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	61.200
Protein coverage (%)	TK1151 71.362 / OH-1004 40.053 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G029680

Location Chr02:7187678-7188723 (+)

Description Similar to MAPKKK18: Mitogen-activated protein kinase kinase kinase 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05100`	Component of the abscisic acid (ABA) signaling pathway that acts as ABA signal transducer in the context of abiotic stresses.	An abscisic acid inducible Arabidopsis MAPKKK, MAPKKK18 regulates leaf senescence via its kinase activity.2015 · DOI: 10.1007/s11103-015-0295-0 Arabidopsis ABA-Activated Kinase MAPKKK18 is Regulated by Protein Phosphatase 2C ABI1 and the Ubiquitin-Proteasome Pathway.2015 · DOI: 10.1093/pcp/pcv146
`At2g32510`	Component of the abscisic acid (ABA) signaling pathway that may act as ABA signal transducer in the context of abiotic stresses.	No verified direct reference in this release
`At1g54960`	Involved in cortical microtubules organization and stabilization by regulating the phosphorylation state of microtubule- associated proteins such as MAP65-1.	Arabidopsis homologs of nucleus- and phragmoplast-localized kinase 2 and 3 and mitogen-activated protein kinase 4 are essential for microtubule organization.2010 · DOI: 10.1105/tpc.109.071746
`At1g18350`	May function as a negative regulator of polar auxin transport.	Increased expression of MAP KINASE KINASE7 causes deficiency in polar auxin transport and leads to plant architectural abnormality in Arabidopsis.2006 · DOI: 10.1105/tpc.105.037846 Overexpression of Arabidopsis MAP kinase kinase 7 leads to activation of plant basal and systemic acquired resistance.2007 · DOI: 10.1111/j.1365-313x.2007.03294.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_038177 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000302 response to reactive oxygen species Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009653 anatomical structure morphogenesis Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010029 regulation of seed germination Biological Process

KEGG gene cross-reference

ath:AT1G05100

ath:AT1G54960

ath:AT2G32510

ath:AT3G50310

ddi:DDB_G0283265

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.453

Rank 1 · TkA02G029680 · TK1151

Cytoplasm0.450

Rank 2 · TkA02G029680 · TK1151

Cell membrane0.073

Rank 3 · TkA02G029680 · TK1151

Plastid0.073

Rank 4 · TkA02G029680 · TK1151

Mitochondrion0.055

Rank 5 · TkA02G029680 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase4-154 aa

PF14531Kinase-like4-35 aa

PF07714PK_Tyr_Ser-Thr6-150 aa

PF15252DUF458915-55 aa

PF01636APH28-118 aa

PF03109ABC176-159 aa

PF01163RIO176-145 aa

PF06176WaaY94-152 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G029680	`PF00069`	Pkinase	4	154	3e-32	112.8
TkA02G029680	`PF14531`	Kinase-like	4	35	0.00072	19.6
TkA02G029680	`PF07714`	PK_Tyr_Ser-Thr	6	150	3.2e-17	63.4
TkA02G029680	`PF15252`	DUF4589	15	55	0.17	12.6
TkA02G029680	`PF01636`	APH	28	118	0.037	14.5
TkA02G029680	`PF03109`	ABC1	76	159	0.0038	17.1
TkA02G029680	`PF01163`	RIO1	76	145	0.0055	17.1
TkA02G029680	`PF06176`	WaaY	94	152	0.046	14.1
TkA02G029680	`PF14531`	Kinase-like	106	146	0.00072	19.6
TkA02G029680	`PF01636`	APH	120	149	0.037	14.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZVP5`	Arabidopsis thaliana	sp\|Q9ZVP5\|M3K18_ARATH Mitogen-activated protein kinase kinase kinase 18	52.100%	Swiss-Prot	High
`O80888`	Arabidopsis thaliana	sp\|O80888\|M3K17_ARATH Mitogen-activated protein kinase kinase kinase 17	54.000%	Swiss-Prot	Medium
`Q9FZ36`	Arabidopsis thaliana	sp\|Q9FZ36\|M3K2_ARATH Mitogen-activated protein kinase kinase kinase 2	36.000%	Swiss-Prot	Medium
`Q9LPQ3`	Arabidopsis thaliana	sp\|Q9LPQ3\|M2K7_ARATH Mitogen-activated protein kinase kinase 7	41.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card