TkA02G029610 | RubberDandelionOmics

Gene overview

TkA02G029610

Reference: TK1151 Chr: Chr02 Coordinates: 7166886-7173022 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2398 bp · TkA02G029610|TK1151|cDNA

CCCCGACAAACTTATAATGACAACATTACTGTTATTTATTTCTTTTTTATTTTTTAAATATCAATAATAAATAAAAAAGTAAACCACTCCTTTGCCCCCACTCCTCATAAACTTACGGGATCGTTCCTAATACTTCAAAAACTTCCATCTTCTTCTCCAACCTATGGCCGCCTCGTCGGTGCCGTTGGTTTCAACCACTGCTGCCATCTTACTAAATCGTCGTCGCAAAAATCGATTTCAGGGGGGTGTTTTCTTGTTGG...

CDS

Download CDS FASTA

1689 bp · TkA02G029610|TK1151|CDS

ATGCTCATCAAAAGCGGTGCTTTATTCTTCCTTTCGTCATATATTGCTCACTACACACGCCTCCGTCATCGTTTCTCTCAAATCTCAGGTGAGTTTAACCTTTTTCCCCAATTCGCCTTCGTCGATTTTCTCCGATCAAGTCGGATTCAACTGATACTGTTGTTCAACATGGGTACGTCAATCAAAGCAAGTGTGCTTGCCTTGTGTTTGCTGTTTCTTCTATCAGCTTCAGCAAATTCAGCCTCTAATGGTGAATTAAT...

Protein

Download Protein FASTA

562 aa · TkA02G029610|TK1151|PROTEIN

MLIKSGALFFLSSYIAHYTRLRHRFSQISGEFNLFPQFAFVDFLRSSRIQLILLFNMGTSIKASVLALCLLFLLSASANSASNGELIRVGLKKRKVDQLNQINGHGVSTQGNVRRNFGLESPLTDSDTDIIELKNYMDAQYYGEIGIGSPPQMFTVIFDTGSSNLWVPSAKCYFSVACLFHSKYKASHSSTYKKNGTSAAIQYGTGAISGFFSQDSVQLGDLVVKEQDFIEATKEPGITFLAAKFDGILGLGFQEISVGN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G029610`
TK1151 ID	TkA02G029610
OH-1004 ID	LXL04_017560
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G029610

Location Chr02:7166886-7173022 (+)

Description Similar to CYPRO1: Cyprosin (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g11910`	Involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0567100`	Involved in the breakdown of propeptides of storage proteins in protein-storage vacuoles.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017560 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0000326 protein storage vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0004175 endopeptidase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G11910

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.551

Rank 1 · TkA02G029610 · TK1151

Extracellular0.199

Rank 2 · TkA02G029610 · TK1151

Cytoplasm0.174

Rank 3 · TkA02G029610 · TK1151

Endoplasmic reticulum0.127

Rank 4 · TkA02G029610 · TK1151

Cell membrane0.118

Rank 5 · TkA02G029610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00026Asp140-561 aa

PF14543TAXi_N141-299 aa

PF03489SapB_2374-407 aa

PF05184SapB_1435-471 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G029610	`PF00026`	Asp	140	561	2.9e-117	392.3
TkA02G029610	`PF14543`	TAXi_N	141	299	8.4e-12	46.3
TkA02G029610	`PF03489`	SapB_2	374	407	2.5e-12	47.4
TkA02G029610	`PF05184`	SapB_1	435	471	2.3e-14	53.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65390`	Arabidopsis thaliana	sp\|O65390\|APA1_ARATH Aspartic proteinase A1	71.900%	Swiss-Prot	High
`Q42456`	Oryza sativa subsp. japonica	sp\|Q42456\|ASPR1_ORYSJ Aspartic proteinase oryzasin-1	66.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card