TkA02G020870 | RubberDandelionOmics

Gene overview

TkA02G020870

Reference: TK1151 Chr: Chr02 Coordinates: 4942787-4945233 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1617 bp · TkA02G020870|TK1151|cDNA

CTTATTTTTGTTTGGGTTAAAGGTTGTCCTTGTTGAAATGTATACGGTGCCCATAATCTCTCAAAATATTTAGGGGTCACGTTCGTCTTCATCCCTCTTCCCTATCTGATGCCTTTTCTCTCTCTGTAATTGTAACGGAAGTTCATTGATCGGAGGAATTTTCTGTTATCCGATCACAAATCCTCATCGGGGAAACCAAGGCATCACAATGAAACGACTATTCAGTTCGAAGGCTCTCACACCAATTGAGCTCGTTCATC...

CDS

Download CDS FASTA

972 bp · TkA02G020870|TK1151|CDS

ATGAAACGACTATTCAGTTCGAAGGCTCTCACACCAATTGAGCTCGTTCATCACGTCCGTGATATTCTTACCTTCGTCAATGAAAATCCGGATATTCGTGAAGCCAAGCGCCAAGAGAAGGCTCGTGAATTAACGAGACTCATTCATGAAATGATGGTGGTACTTTATGGCGACGATACATGTCAACCACATGTAGAACCTTGTGCGAAATTAACTCAGGAATTCTTCAAGGAGGATATATTGCGTCTTCTAGTCGGTTA...

Protein

Download Protein FASTA

323 aa · TkA02G020870|TK1151|PROTEIN

MKRLFSSKALTPIELVHHVRDILTFVNENPDIREAKRQEKARELTRLIHEMMVVLYGDDTCQPHVEPCAKLTQEFFKEDILRLLVGYLPYMDPGARQDITHVVANLLRQKVHNRCVGAEYLEKNTDILDLLIPGYDDPETAISFGAILRECVWHQVAARYILESDHMKTFFNYQHDANFDIESDASATFTELLTRHKSTVAEYLNNNYDWFFTEYNKLLESANYITRRNAIKLLGAMLLDRSYSSVMVRYVSSLENMRIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G020870`
TK1151 ID	TkA02G020870
OH-1004 ID	LXL04_017621
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.071 / OH-1004 91.168 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G020870

Location Chr02:4942787-4945233 (-)

Description Similar to At5g47540: Putative MO25-like protein At5g47540

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g47540`	Putative MO25-like protein At5g47540.	No verified direct reference in this release
`At4g17270`	Putative MO25-like protein At4g17270.	No verified direct reference in this release
`At2g03410`	MO25-like protein At2g03410.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017621 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0043539 protein serine/threonine kinase activator activity Molecular Function

KEGG gene cross-reference

ath:AT2G03410

ath:AT4G17270

ath:AT5G47540

hsa:81617

mmu:69008

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.679

Rank 1 · TkA02G020870 · TK1151

Nucleus0.203

Rank 2 · TkA02G020870 · TK1151

Cell membrane0.156

Rank 3 · TkA02G020870 · TK1151

Golgi apparatus0.107

Rank 4 · TkA02G020870 · TK1151

Lysosome / Vacuole0.096

Rank 5 · TkA02G020870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08569Mo254-321 aa

PF02985HEAT28-35 aa

PF04428Choline_kin_N43-51 aa

PF04428Choline_kin_N70-84 aa

PF13646HEAT_2123-147 aa

PF02985HEAT127-141 aa

PF23227HEAT_MROH2B_C150-277 aa

PF02985HEAT217-238 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G020870	`PF08569`	Mo25	4	321	4.3e-110	368.8
TkA02G020870	`PF02985`	HEAT	28	35	0.11	13.5
TkA02G020870	`PF04428`	Choline_kin_N	43	51	0.089	13.2
TkA02G020870	`PF04428`	Choline_kin_N	70	84	0.089	13.2
TkA02G020870	`PF13646`	HEAT_2	123	147	0.27	12.2
TkA02G020870	`PF02985`	HEAT	127	141	0.11	13.5
TkA02G020870	`PF23227`	HEAT_MROH2B_C	150	277	0.0021	18.1
TkA02G020870	`PF02985`	HEAT	217	238	0.11	13.5
TkA02G020870	`PF13646`	HEAT_2	218	270	0.27	12.2
TkA02G020870	`PF04826`	Arm_2	229	295	0.037	14.2
TkA02G020870	`PF02985`	HEAT	258	277	0.11	13.5
TkA02G020870	`PF13646`	HEAT_2	260	280	0.27	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGK3`	Arabidopsis thaliana	sp\|Q9FGK3\|MO25N_ARATH Putative MO25-like protein At5g47540	58.000%	Swiss-Prot	High
`Q9M0M4`	Arabidopsis thaliana	sp\|Q9M0M4\|MO25M_ARATH Putative MO25-like protein At4g17270	55.900%	Swiss-Prot	High
`Q9ZQ77`	Arabidopsis thaliana	sp\|Q9ZQ77\|MO25L_ARATH MO25-like protein At2g03410	51.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card