TkA02G019750 | RubberDandelionOmics

Gene overview

TkA02G019750

Reference: TK1151 Chr: Chr02 Coordinates: 4611155-4616085 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2774 bp · TkA02G019750|TK1151|cDNA

TCGGACTCGGATCTACAAGGACGCCCATCTCCAGAAGCTTCCTTAAACCCCTATTTTCTTCTCTCAAACCCTATCAAAACCCTTGCGCAGTCTCGGAGAACAATTTCATTTCATTTCTGTTAGCTTCGATCCCACAAACATGCACAGGCTATCCAGACGTTCTGTCAACTCACTCCTCCGCTACGGTGGCCATCGCCACCGTGATGCCATAGCTGCAGCCTCCATTGGTTCTTTGAATGTCAACGAATTGAGTGGAGAGA...

CDS

Download CDS FASTA

2403 bp · TkA02G019750|TK1151|CDS

ATGCACAGGCTATCCAGACGTTCTGTCAACTCACTCCTCCGCTACGGTGGCCATCGCCACCGTGATGCCATAGCTGCAGCCTCCATTGGTTCTTTGAATGTCAACGAATTGAGTGGAGAGAGGGATGCCAGTGGCAGATGGTACTCAATTCTAACAACCCCAACAAGCAGTGGGCCCGCTTCCACAAAGCCTTTGAAATTAGGAAACCATATTTCTACTGGGATCCGGTATGAGTCAACTGCTTCTGACTTTCAAACACC...

Protein

Download Protein FASTA

800 aa · TkA02G019750|TK1151|PROTEIN

MHRLSRRSVNSLLRYGGHRHRDAIAAASIGSLNVNELSGERDASGRWYSILTTPTSSGPASTKPLKLGNHISTGIRYESTASDFQTPDPPVEKYEYQAEVSRLMDLIVNSLYSNKEVFLRELISNASDALDKLRFLSVTDQQLLEGASELDIRIKTDQENGIITIQDSGIGMTHQELVDSLGTIAHSGTAKFLKALKDSKDAGSDSNLIGQFGVGFYSAFLVADKVVVSTKSPKSDKQYVWEGEANSSSYIIKEETDPEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G019750`
TK1151 ID	TkA02G019750
OH-1004 ID	LXL04_017643
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G019750

Location Chr02:4611155-4616085 (-)

Description Similar to HSP90-6: Heat shock protein 90-6, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07770`	Molecular chaperone which stabilizes unfolding protein intermediates and functions as a folding molecular chaperone that assists the non-covalent folding of proteins in an ATP-dependent manner.	No verified direct reference in this release
`At2g04030`	Molecular chaperone required for chloroplast biogenesis.	The chlorate-resistant and photomorphogenesis-defective mutant cr88 encodes a chloroplast-targeted HSP90.2003 · DOI: 10.1046/j.1365-313x.2003.016011.x
`At4g24190`	May have a molecular chaperone role in the processing of secreted materials.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017643 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009704 de-etiolation Biological Process

GO:0010157 response to chlorate Biological Process

GO:0034605 cellular response to heat Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0050821 protein stabilization Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT2G04030

ath:AT3G07770

ini:109146489

tpv:TP02_0244

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.931

Rank 1 · TkA02G019750 · TK1151

Cytoplasm0.078

Rank 2 · TkA02G019750 · TK1151

Nucleus0.055

Rank 3 · TkA02G019750 · TK1151

Cell membrane0.025

Rank 4 · TkA02G019750 · TK1151

Plastid0.021

Rank 5 · TkA02G019750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08462Carmo_coat_C29-80 aa

PF25794SACS110-130 aa

PF13589HATPase_c_3116-250 aa

PF02518HATPase_c116-274 aa

PF25794SACS204-226 aa

PF00183HSP90279-774 aa

PF28239Npun_R2479334-393 aa

PF25794SACS557-601 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G019750	`PF08462`	Carmo_coat_C	29	80	0.13	13.1
TkA02G019750	`PF25794`	SACS	110	130	0.031	14.8
TkA02G019750	`PF13589`	HATPase_c_3	116	250	8e-09	36.4
TkA02G019750	`PF02518`	HATPase_c	116	274	4.4e-06	27.8
TkA02G019750	`PF25794`	SACS	204	226	0.031	14.8
TkA02G019750	`PF00183`	HSP90	279	774	7.2e-192	639.6
TkA02G019750	`PF28239`	Npun_R2479	334	393	0.12	12.1
TkA02G019750	`PF25794`	SACS	557	601	0.031	14.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JFN3`	Arabidopsis thaliana	sp\|F4JFN3\|HS906_ARATH Heat shock protein 90-6, mitochondrial	72.500%	Swiss-Prot	High
`Q9SIF2`	Arabidopsis thaliana	sp\|Q9SIF2\|HS905_ARATH Heat shock protein 90-5, chloroplastic	69.900%	Swiss-Prot	High
`Q9STX5`	Arabidopsis thaliana	sp\|Q9STX5\|ENPL_ARATH Endoplasmin homolog	44.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card