TkA02G011660 | RubberDandelionOmics

Gene overview

TkA02G011660

Reference: TK1151 Chr: Chr02 Coordinates: 2571965-2575051 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1825 bp · TkA02G011660|TK1151|cDNA

AAATTAACCCCCTCTGTTTGCTCACGAAATCAAAATCAACGATCAATTCAAGACACAGACTGCGATCAAAAGCAAAAAAAAGAACGATTAATTGACACCAATGTCAGTGACGGTGGAAGAGGAAGAAAAGCGAATGGTAGTAATTCAATCAAACTCAGTGTACGTTCAATAAACTACGACATGCAAACACAAAAATGGGGGATATACTTCAAGAACAGATCAATTCCCATTTGATTTTAGGAACCACATTATGTCTACGA...

CDS

Download CDS FASTA

1359 bp · TkA02G011660|TK1151|CDS

ATGCATTCCAAGTTCTGGCTCTCTGTAACAATGGGTACCACCAGCAATTTGCGGATTATCGGATTCAATTCCCATTTAGAAATGGGATCAGTAGATGGAATTGGAAAGTCAACAATGGAGTTATCGGATGATAGTCGTGCTGTCCCGGTTACAACAACAAGAAACCTGGCAACCCTTAAAAGTAACTCGGAGGATTTTGGCACGAATTATATATGGAGAATAGTGGCTGGCAGTATAAAAACTGCTTTCTTCTCTGATAA...

Protein

Download Protein FASTA

452 aa · TkA02G011660|TK1151|PROTEIN

MHSKFWLSVTMGTTSNLRIIGFNSHLEMGSVDGIGKSTMELSDDSRAVPVTTTRNLATLKSNSEDFGTNYIWRIVAGSIKTAFFSDKISFLLPCGPLAMLVDQLTERHGWVFLLSLLGIIPLAERLGWATEQLVFYTGPTVGSLLNATFGNATELIISLFAMKHGMLRLVQQSLLGSILSNMLLVLGCALFTGGIVHRHKEQIFNKSNAGMNVGLLLMAVMGLLFPTLLHETQTELEIGTSELVLSRFCSCILLVAYGVY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA02G011660`
TK1151 ID	TkA02G011660
OH-1004 ID	LXL04_017679
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA02G011660

Location Chr02:2571965-2575051 (-)

Description Similar to CAX5: Vacuolar cation/proton exchanger 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g55730`	Vacuolar cation/proton exchanger (CAX).	No verified direct reference in this release
`At3g13320`	Vacuolar cation/proton exchanger (CAX).	Manganese specificity determinants in the Arabidopsis metal/H+ antiporter CAX2.2003 · DOI: 10.1074/jbc.m209952200
`At1g55720`	Vacuolar cation/proton exchanger (CAX).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0397400`	Vacuolar cation/proton exchanger (CAX).	Expression profile of the genes for rice cation/H+ exchanger family and functional analysis in yeast.2005 · DOI: 10.1093/pcp/pci173
`Os04g0653200`	Vacuolar cation/proton exchanger (CAX).	Expression profile of the genes for rice cation/H+ exchanger family and functional analysis in yeast.2005 · DOI: 10.1093/pcp/pci173

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017679 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006816 calcium ion transport Biological Process

GO:0006874 intracellular calcium ion homeostasis Biological Process

GO:0030001 metal ion transport Biological Process

GO:0070588 calcium ion transmembrane transport Biological Process

GO:0005773 vacuole Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0015369 calcium:proton antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G55720

ath:AT1G55730

ath:AT3G13320

dosa:Os03g0397400

dosa:Os04g0653200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.415

Rank 1 · TkA02G011660 · TK1151

Lysosome / Vacuole0.303

Rank 2 · TkA02G011660 · TK1151

Cytoplasm0.166

Rank 3 · TkA02G011660 · TK1151

Endoplasmic reticulum0.125

Rank 4 · TkA02G011660 · TK1151

Golgi apparatus0.105

Rank 5 · TkA02G011660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01080Presenilin86-111 aa

PF01699Na_Ca_ex110-265 aa

PF01080Presenilin170-248 aa

PF10864DUF2663196-271 aa

PF04276DUF443200-311 aa

PF01699Na_Ca_ex294-432 aa

PF01080Presenilin298-345 aa

PF01080Presenilin398-438 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA02G011660	`PF01080`	Presenilin	86	111	3.1	7.2
TkA02G011660	`PF01699`	Na_Ca_ex	110	265	7.8e-46	156.5
TkA02G011660	`PF01080`	Presenilin	170	248	3.1	7.2
TkA02G011660	`PF10864`	DUF2663	196	271	7.5	7.6
TkA02G011660	`PF04276`	DUF443	200	311	8.8	6.8
TkA02G011660	`PF01699`	Na_Ca_ex	294	432	7.8e-46	156.5
TkA02G011660	`PF01080`	Presenilin	298	345	3.1	7.2
TkA02G011660	`PF01080`	Presenilin	398	438	3.1	7.2
TkA02G011660	`PF04276`	DUF443	399	428	8.8	6.8
TkA02G011660	`PF10864`	DUF2663	400	421	7.5	7.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L783`	Arabidopsis thaliana	sp\|Q8L783\|CAX5_ARATH Vacuolar cation/proton exchanger 5	60.000%	Swiss-Prot	High
`Q39254`	Arabidopsis thaliana	sp\|Q39254\|CAX2_ARATH Vacuolar cation/proton exchanger 2	64.300%	Swiss-Prot	High
`Q9LFZ8`	Arabidopsis thaliana	sp\|Q9LFZ8\|CAX6_ARATH Putative vacuolar cation/proton exchanger 6	58.200%	Swiss-Prot	High
`Q5KQN0`	Oryza sativa subsp. japonica	sp\|Q5KQN0\|CAX2_ORYSJ Vacuolar cation/proton exchanger 2	64.000%	Swiss-Prot	High
`Q6K1C4`	Oryza sativa subsp. japonica	sp\|Q6K1C4\|CAX3_ORYSJ Vacuolar cation/proton exchanger 3	66.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card