TkA01G627840 | RubberDandelionOmics

Gene overview

TkA01G627840

Reference: TK1151 Chr: Chr01 Coordinates: 158763763-158769012 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2668 bp · TkA01G627840|TK1151|cDNA

AATCAGACCACTTTACCAAATGTTGCGGGATTGGAACCATAGGGTTTAGAGAGCAAAGTTCAAAACAAAGAGGTAGGGTTTAGAGGCAAGCAAACAAACACCACACCACTGTAATTTCCCACCCATTTTCCACTGCTGCTACCATCGTTATCTTCGCTTACGCTCACACTCCAACGACGAAAACTACTTTCATGAGCAGACTGTAGATGAATGGCTTTTCTTAAACCTCATCATTCAACAACATATTACAATTCACTTCG...

CDS

Download CDS FASTA

2214 bp · TkA01G627840|TK1151|CDS

ATGGCTTTTCTTAAACCTCATCATTCAACAACATATTACAATTCACTTCGTCTAATCATGTCCTCAAGGTTCTGGCTATCAACTCATGGCATCTCTGTCTGCTCTATCCGTCCTTCTCCACCCTCTATCCTCCTAAAACACAGGTCAAATTTGGGAGTGAGAACTCTATCAACCAATAGGGTTTTGGTTCCAAGTGCTTTGGTACGTCCAAGAGCTTTTATGTCGACGTCTTCTTCATCAAGCTCTGCTACTGAAGTTCG...

Protein

Download Protein FASTA

737 aa · TkA01G627840|TK1151|PROTEIN

MAFLKPHHSTTYYNSLRLIMSSRFWLSTHGISVCSIRPSPPSILLKHRSNLGVRTLSTNRVLVPSALVRPRAFMSTSSSSSSATEVRKEKDGSEHYGSENIQILEGLDAVRKRPGMYIGSTGFRGLHHLVYEILDNCVDEAQAGFASKVDIVLLEDGSVCITDNGRGIPIDLHPGSKKSGVETVLTVLHAGGKFGGASSGYKVSGGLHGVGLSVVNALSETLEVTVWRDGKECKQSYVRGKPLAPLSCEDLSPEAKDRTG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G627840`
TK1151 ID	TkA01G627840
OH-1004 ID	LXL04_000197
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G627840

Location Chr01:158763763-158769012 (+)

Description Similar to GYRB: DNA gyrase subunit B, chloroplastic/mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g04130`	A type II topoisomerase that negatively supercoils closed circular double-stranded DNA in an ATP-dependent manner.	No verified direct reference in this release
`At3g10270`	A type II topoisomerase that negatively supercoils closed circular double-stranded DNA in an ATP-dependent manner.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0268300`	A type II topoisomerase that negatively supercoils closed circular double-stranded DNA in an ATP-dependent manner.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000197 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006265 DNA topological change Biological Process

GO:0005694 chromosome Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042644 chloroplast nucleoid Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0034335 DNA negative supercoiling activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT3G10270

ath:AT5G04130

dosa:Os01g0268300

tma:TM0833

tmi:THEMA_00475

tmm:Tmari_0835

tmw:THMA_0854

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.849

Rank 1 · TkA01G627840 · TK1151

Plastid0.115

Rank 2 · TkA01G627840 · TK1151

Cytoplasm0.083

Rank 3 · TkA01G627840 · TK1151

Nucleus0.050

Rank 4 · TkA01G627840 · TK1151

Peroxisome0.029

Rank 5 · TkA01G627840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02518HATPase_c125-268 aa

PF00204DNA_gyraseB321-490 aa

PF01751Toprim331-351 aa

PF01751Toprim519-620 aa

PF21249GyrB_hook556-562 aa

PF21249GyrB_hook633-650 aa

PF16898TOPRIM_C633-731 aa

PF00986DNA_gyraseB_C663-724 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G627840	`PF02518`	HATPase_c	125	268	1.1e-15	58.8
TkA01G627840	`PF00204`	DNA_gyraseB	321	490	1.1e-55	188.6
TkA01G627840	`PF01751`	Toprim	331	351	1.3e-18	67.7
TkA01G627840	`PF01751`	Toprim	519	620	1.3e-18	67.7
TkA01G627840	`PF21249`	GyrB_hook	556	562	0.032	14.5
TkA01G627840	`PF21249`	GyrB_hook	633	650	0.032	14.5
TkA01G627840	`PF16898`	TOPRIM_C	633	731	0.18	12.7
TkA01G627840	`PF00986`	DNA_gyraseB_C	663	724	2.8e-23	82.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BZ7`	Arabidopsis thaliana	sp\|Q94BZ7\|GYRBM_ARATH DNA gyrase subunit B, mitochondrial	75.900%	Swiss-Prot	High
`Q9SS38`	Arabidopsis thaliana	sp\|Q9SS38\|GYRBP_ARATH DNA gyrase subunit B, chloroplastic	73.500%	Swiss-Prot	High
`Q5NBJ3`	Oryza sativa subsp. japonica	sp\|Q5NBJ3\|GYRB_ORYSJ DNA gyrase subunit B, chloroplastic/mitochondrial	70.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card